New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913_3_pae_tpiA | = 4296196 | 1 (0.030) | 5 (0.150) | 5/270 | 4.0 | 33.4% | noncoding (446/600 nt) | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites |
? | NC_000913_3_pae_tpiA | = 4296279 | 19 (0.570) | noncoding (529/600 nt) | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | |||||
Rejected: Coverage evenness skew score above cutoff. |
GCCGCATCCGACATCAACGCCTGATGCGACGCTTAACGCGTCTTATCAGGCCTACGCCAGACAGCGCAATAGCCTGATTTAGCGTGATTTTGTAGGTCGGATAAGGCGTTTATGCCGCATCCGACATCAACGCCTGATGCGACGCTTAA > NC_000913_3_pae_tpiA/4296072‑4296220 | gCCGCATCCGACATCAACGCCTGATGCGACGCTTAACGCGTCTTATCAGGCCTACGCCAGACAGCGCAATAGCCTGATTTAGCGTGATTTTGTAGGTCGGATAAGGCGTTTATGCTGCATCCGACGTCATTGCCTGTTGCGACGCttgc > 1:363711/1‑147 (MQ=11) | GCCGCATCCGACATCAACGCCTGATGCGACGCTTAACGCGTCTTATCAGGCCTACGCCAGACAGCGCAATAGCCTGATTTAGCGTGATTTTGTAGGTCGGATAAGGCGTTTATGCCGCATCCGACATCAACGCCTGATGCGACGCTTAA > NC_000913_3_pae_tpiA/4296072‑4296220 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 8 ≤ ATCG/ATCG < 12 ≤ ATCG/ATCG < 27 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |