mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence (highest frequency 20 of 193 shown, sorted by frequency from high to low) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | AssemblyC74_contig_12 | 59,194 | 0 | C | T | 74.9% | 2766.8 / inf | 1718 | T48T (ACG→ACA) ‡ | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| * | AssemblyC74_contig_12 | 59,195 | 0 | G | A | 74.6% | 2717.1 / inf | 1726 | T48M (ACG→ATG) ‡ | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| * | AssemblyC74_contig_12 | 59,062 | 0 | T | C | 74.2% | 3188.7 / inf | 1676 | G92G (GGA→GGG) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| * | AssemblyC74_contig_15 | 33,161 | 0 | T | G | 73.8% | 4748.8 / inf | 2240 | T194P (ACC→CCC) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| * | AssemblyC74_contig_1 | 117 | 0 | C | T | 73.5% | 1402.8 / inf | 1386 | intergenic (–/‑475) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| * | AssemblyC74_contig_43 | 1,217 | 0 | A | G | 73.4% | 3528.0 / inf | 1896 | intergenic (‑2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| * | AssemblyC74_contig_12 | 59,225 | 0 | A | G | 72.5% | 1456.2 / inf | 993 | V38A (GTG→GCG) ‡ | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| * | AssemblyC74_contig_12 | 59,224 | 0 | C | T | 72.5% | 1358.2 / inf | 993 | V38V (GTG→GTA) ‡ | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| * | AssemblyC74_contig_15 | 33,109 | 0 | T | G | 71.5% | 3951.8 / inf | 2023 | K211T (AAA→ACA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| * | AssemblyC74_contig_1 | 198 | 0 | A | G | 70.2% | 1201.8 / inf | 885 | intergenic (–/‑394) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| * | AssemblyC74_contig_43 | 1,046 | 0 | T | G | 69.1% | 3196.3 / inf | 1892 | E57A (GAA→GCA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| * | AssemblyC74_contig_1 | 65 | 0 | T | C | 68.9% | 288.5 / inf | 805 | intergenic (–/‑527) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| * | AssemblyC74_contig_1 | 66 | 0 | A | G | 68.7% | 282.2 / inf | 809 | intergenic (–/‑526) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| * | AssemblyC74_contig_12 | 59,239 | 0 | G | A | 67.8% | 1140.3 / inf | 1036 | G33G (GGC→GGT) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| * | AssemblyC74_contig_30 | 153 | 0 | A | G | 66.6% | 1130.1 / inf | 1187 | T51T (ACA→ACG) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein |
| * | AssemblyC74_contig_30 | 166 | 0 | T | C | 65.3% | 1288.0 / inf | 1459 | L56L (TTA→CTA) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein |
| * | AssemblyC74_contig_30 | 210 | 0 | T | C | 64.6% | 1155.7 / inf | 1449 | R70R (CGT→CGC) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein |
| * | AssemblyC74_contig_47 | 485 | 0 | G | A | 64.3% | 1642.0 / inf | 1645 | D162N (GAT→AAT) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| * | AssemblyC74_contig_15 | 33,663 | 0 | C | A | 64.1% | 864.1 / inf | 861 | T26T (ACG→ACT) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| * | AssemblyC74_contig_44 | 666 | 0 | T | C | 61.6% | 2824.7 / inf | 2975 | K157K (AAA→AAG) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| Marginal new junction evidence (lowest skew 10 of 40 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | AssemblyC74_contig_47 | = 622 | NA (NA) | 22 (0.030) +GATACGTCAAATGTTACGAA |
10/208 | 0.9 | 5.7% | noncoding (21/29 nt) | direct | CRISPR repeat with sequence agtgtagatgtaagtaattggaatacgtc |
| ? | AssemblyC74_contig_61 | = 87 | 434 (0.300) | coding (336/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | 487 = | NA (NA) | 6 (0.010) +CTTGTAACATTT |
6/224 | 1.8 | 11.5% | coding (486/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_61 | 22 = | 51 (0.040) | coding (401/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_61 | 1 = | 0 (0.000) | 4 (0.000) | 3/230 | 3.0 | 2.1% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_61 | = 78 | 380 (0.290) | coding (345/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_40 | = 62 | NA (NA) | 230 (0.680) +G |
47/246 | 3.0 | 100% | intergenic (–/+119) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Cold shock protein of CSP family |
| ? | AssemblyC74_contig_5 | 1 = | 0 (0.000) | intergenic (–/+540) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/FIG00627359: hypothetical protein | |||||
| * | ? | AssemblyC74_contig_13 | 1 = | 0 (0.000) | 185 (0.590) | 43/248 | 3.2 | 73.7% | coding (1/234 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Transcriptional antiterminator of lichenan operon, BglG family |
| ? | AssemblyC74_contig_34 | 2046 = | 132 (0.420) | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– | |||||
| * | ? | AssemblyC74_contig_1 | = 261 | 377 (0.900) | 294 (0.700) | 57/246 | 3.3 | 61.1% | intergenic (–/‑331) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| ? | AssemblyC74_contig_7 | 2 = | 0 (0.000) | intergenic (–/+269) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Lysyl‑tRNA synthetase (class II) (EC 6.1.1.6) | |||||
| * | ? | AssemblyC74_contig_25 | = 8555 | 0 (0.000) | 218 (0.710) +A |
41/246 | 3.5 | 76.9% | intergenic (+310/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_34 | 2046 = | 132 (0.420) | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– | |||||
| * | ? | AssemblyC74_contig_16 | 35042 = | NA (NA) | 136 (0.450) +G |
42/246 | 4.1 | 100% | intergenic (+88/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_4 | = 189292 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_12 | = 59001 | 277 (0.670) | 347 (0.850) | 51/242 | 4.3 | 71.5% | coding (337/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| ? | AssemblyC74_contig_18 | = 27071 | 6 (0.010) | coding (2229/2232 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_41 | = 246 | 586 (0.580) | 475 (0.470) | 81/248 | 4.7 | 45.0% | intergenic (‑7/+105) | rasttk_feature_annotation_tool=elepa@bvbrc/rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein/hypothetical protein |
| ? | AssemblyC74_contig_41 | 250 = | 576 (0.570) | intergenic (‑11/+101) | rasttk_feature_annotation_tool=elepa@bvbrc/rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein/hypothetical protein | |||||