mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| RA | AssemblyC74_contig_1 | 380,718 | +G | coding (472/1422 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 → | Amino acid permease family protein |
| RA | AssemblyC74_contig_1 | 443,385 | G→A | intergenic (+514/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity → / – | Conserved hypothetical protein ArsC related/– |
| RA | AssemblyC74_contig_1 | 443,483 | (T)6→5 | intergenic (+612/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity → / – | Conserved hypothetical protein ArsC related/– |
| RA | AssemblyC74_contig_12 | 59,113 | A→G | N75N (AAT→AAC) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,182 | C→T | L52L (TTG→TTA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,248 | C→T | A30A (GCG→GCA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,264 | G→T | A25E (GCA→GAA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,272 | G→A | T22T (ACC→ACT) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_15 | 32,991 | A→G | H250H (CAT→CAC) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Mobile element protein |
| RA | AssemblyC74_contig_3 | 97,014 | C→T | Q137* (CAG→TAG) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 → | Carbonic anhydrase, alpha class (EC 4.2.1.1) |
| JC | AssemblyC74_contig_47 | 726 | 17 bp→95 bp | coding (725‑741/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc → | hypothetical protein |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | AssemblyC74_contig_11 | 78783 | 78787 | 5 | 270 [0] | [0] NA | [rasttk_feature_annotation_tool=elepa@bvbrc] | [rasttk_feature_annotation_tool=elepa@bvbrc] |
| * | * | ÷ | AssemblyC74_contig_12 | 1 | 7 | 7 | NA [0] | [0] 277 | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Polygalacturonase (EC 3.2.1.15) |
| * | * | ÷ | AssemblyC74_contig_12 | 59277 | 59337 | 61 | 298 [35] | [0] NA | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| * | * | ÷ | AssemblyC74_contig_48 | 1 | 21 | 21 | NA [0] | [1] 511 | [rasttk_feature_annotation_tool=annotate_proteins_km er_v2] | [rasttk_feature_annotation_tool=annotate_proteins_km er_v2] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | AssemblyC74_contig_1 | = 221 | 469 (1.120) | 267 (0.680) | 58/234 | 2.7 | 54.7% | intergenic (–/‑371) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| ? | AssemblyC74_contig_12 | 8 = | 0 (0.000) | intergenic (–/+152) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Polygalacturonase (EC 3.2.1.15) | |||||
| * | ? | AssemblyC74_contig_1 | 443129 = | 335 (0.800) | 234 (0.610) | 59/238 | 2.4 | 59.3% | intergenic (+258/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved hypothetical protein ArsC related/– |
| ? | AssemblyC74_contig_11 | = 78782 | 0 (0.000) | coding (62/66 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_1 | 443402 = | 1381 (3.300) | 276 (0.730) | 65/248 | 1.7 | 28.6% | intergenic (+531/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved hypothetical protein ArsC related/– |
| ? | AssemblyC74_contig_6 | = 168934 | 0 (0.000) | intergenic (+543/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Phosphate regulon sensor protein PhoR (SphS) (EC 2.7.13.3)/– | |||||
| * | ? | AssemblyC74_contig_1 | = 443528 | 12 (0.030) | 2754 (1.810) +C |
157/246 | 0.0 | 99.8% | intergenic (+657/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved hypothetical protein ArsC related/– |
| ? | AssemblyC74_contig_39 | = 1643 | 0 (0.000) | intergenic (‑5/–) | rasttk_feature_creation_tool=RNA_reps_SSU_rRNA/– | SSU rRNA ## 16S rRNA, small subunit ribosomal RNA/– | |||||
| * | ? | AssemblyC74_contig_10 | = 98564 | 0 (0.000) | 287 (0.630) | 77/248 | 0.5 | 100% | intergenic (‑281/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_50 | 1 = | 0 (0.000) | intergenic (–/‑113) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Aggregation promoting factor | |||||
| * | ? | AssemblyC74_contig_11 | 1 = | 0 (0.000) | 370 (0.340) | 101/248 | 0.1 | 100% | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Alcohol dehydrogenase (EC 1.1.1.1) |
| ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– | |||||
| * | ? | AssemblyC74_contig_12 | 58967 = | 472 (1.140) | 119 (1.140) | 25/64 | 0.3 | 66.7% | coding (371/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| ? | AssemblyC74_contig_12 | = 59245 | 0 (0.000) | coding (93/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog | |||||
| * | ? | AssemblyC74_contig_12 | 59059 = | 186 (0.450) | 693 (1.750) +ATCCTG |
83/236 | 0.6 | 81.9% | coding (279/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| ? | AssemblyC74_contig_18 | 27021 = | 136 (0.320) | coding (2179/2232 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_12 | = 59276 | 35 (0.080) | 258 (0.620) | 63/248 | 2.7 | 93.7% | coding (62/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| ? | AssemblyC74_contig_18 | = 27075 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_13 | = 46240 | 0 (0.000) | 252 (0.760) | 64/248 | 1.5 | 61.8% | intergenic (‑38/–) | rasttk_feature_creation_tool=tRNAscan‑SE/– | tRNA‑Ser‑GGA/– |
| ? | AssemblyC74_contig_8 | = 1721 | 312 (0.870) | intergenic (+1/+137) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_annotation_tool=annotate_proteins_si milarity | tRNA‑Asn‑GTT/FIG00629206: hypothetical protein | |||||
| * | ? | AssemblyC74_contig_14 | = 41348 | 0 (0.000) | 271 (0.570) | 79/248 | 0.5 | 100% | coding (927/927 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Phage endopeptidase |
| ? | AssemblyC74_contig_33 | 1 = | 0 (0.000) | coding (1/972 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_15 | 1 = | 0 (0.000) | 625 (0.870) | 97/248 | 0.6 | 100% | intergenic (–/+1116) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_52 | = 702 | 0 (0.000) | intergenic (+23/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Putative transposase InsK for insertion sequence element IS150/– | |||||
| * | ? | AssemblyC74_contig_15 | 32682 = | 1425 (2.420) | 471 (0.870) | 96/246 | 0.4 | 36.4% | coding (1059/1284 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| ? | AssemblyC74_contig_30 | 32 = | 235 (0.480) | coding (32/252 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_15 | = 36007 | 0 (0.000) | 475 (0.560) | 103/248 | 0.4 | 100% | intergenic (+1/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | FIG00632365: hypothetical protein/– |
| ? | AssemblyC74_contig_37 | = 1750 | 0 (0.000) | intergenic (‑2/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | FIG00632365: hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_16 | = 21988 | 318 (1.000) | 281 (0.860) | 52/242 | 2.9 | 47.6% | coding (146/387 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_2 | = 131967 | 309 (0.900) | intergenic (‑305/+164) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Uncharacterized membrane protein YwzB/ATP synthase epsilon chain (EC 3.6.3.14) | |||||
| * | ? | AssemblyC74_contig_17 | 1 = | 0 (0.000) | 314 (0.570) | 75/248 | 1.0 | 100% | intergenic (–/‑262) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Protein of unknown function DUF421 |
| ? | AssemblyC74_contig_57 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_17 | = 32032 | 0 (0.000) | 298 (0.860) +A |
49/246 | 2.2 | 82.0% | intergenic (+380/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_34 | 2046 = | 132 (0.420) | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– | |||||
| * | ? | AssemblyC74_contig_19 | = 19031 | 0 (0.000) | 345 (0.640) | 87/248 | 0.3 | 100% | intergenic (+109/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Phage lysin, N‑acetylmuramoyl‑L‑alanine amidase (EC 3.5.1.28)/– |
| ? | AssemblyC74_contig_53 | = 622 | 0 (0.000) | coding (1/498 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_2 | 1 = | 0 (0.000) | 217 (0.660) +A |
56/246 | 1.4 | 76.8% | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_34 | 2046 = | 132 (0.420) | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– | |||||
| * | ? | AssemblyC74_contig_2 | 242781 = | 379 (1.080) | 196 (1.170) +64 bp |
34/120 | 1.0 | 54.5% | intergenic (+57/‑806) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Exodeoxyribonuclease III (EC 3.1.11.2)/DNA polymerase III, epsilon subunit and related 3'‑5' exonucleases |
| ? | AssemblyC74_contig_2 | = 242837 | 303 (0.870) | intergenic (+113/‑750) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Exodeoxyribonuclease III (EC 3.1.11.2)/DNA polymerase III, epsilon subunit and related 3'‑5' exonucleases | |||||
| * | ? | AssemblyC74_contig_20 | 1 = | 0 (0.000) | 347 (0.640) | 75/248 | 1.0 | 100% | intergenic (–/+131) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Mobile element protein |
| ? | AssemblyC74_contig_57 | = 493 | 0 (0.000) | coding (1/492 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_20 | = 15862 | 0 (0.000) | 308 (0.320) +40 bp |
66/168 | 0.2 | 100% | intergenic (+12/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Glutathione peroxidase (EC 1.11.1.9) @ Thioredoxin peroxidase (EC 1.11.1.15)/– |
| ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation | |||||
| * | ? | AssemblyC74_contig_21 | 1 = | 0 (0.000) | 263 (0.510) | 64/248 | 1.4 | 100% | intergenic (–/+243) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Sucrose operon repressor ScrR, LacI family |
| ? | AssemblyC74_contig_57 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_21 | = 10843 | 0 (0.000) | 295 (0.590) | 83/248 | 0.3 | 100% | intergenic (+54/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– |
| ? | AssemblyC74_contig_49 | = 764 | 0 (0.000) | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– | |||||
| * | ? | AssemblyC74_contig_23 | 1 = | 0 (0.000) | 308 (0.600) | 82/248 | 0.4 | 100% | coding (237/237 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| ? | AssemblyC74_contig_57 | = 493 | 0 (0.000) | coding (1/492 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_23 | = 9396 | 0 (0.000) | 311 (0.630) | 80/248 | 0.4 | 100% | intergenic (+36/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | DNA‑directed RNA polymerase beta subunit (EC 2.7.7.6)/– |
| ? | AssemblyC74_contig_49 | 1 = | 0 (0.000) | intergenic (–/‑111) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_24 | 1 = | 0 (0.000) | 331 (0.860) +CTGACGTGTCCGT |
74/222 | 0.8 | 61.8% | coding (1/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_24 | = 215 | 458 (1.060) | coding (215/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_24 | 1 = | 0 (0.000) | 186 (0.800) +57 bp |
59/134 | 0.1 | 100% | coding (1/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_7 | = 152772 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_24 | 255 = | 452 (1.050) | 30 (0.430) +103 bp |
14/42 | 0.5 | 29.6% | coding (255/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_24 | = 265 | 427 (0.990) | coding (265/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_26 | 1 = | 0 (0.000) | 373 (0.530) | 86/248 | 0.8 | 100% | intergenic (–/‑20) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Pro‑TGG |
| ? | AssemblyC74_contig_54 | = 611 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_creation_tool=tRNAscan‑SE/– | tRNA‑Arg‑ACG/– | |||||
| * | ? | AssemblyC74_contig_27 | 1 = | 0 (0.000) | 477 (0.580) | 86/248 | 0.9 | 100% | intergenic (–/‑26) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Undecaprenyl‑phosphate galactosephosphotransferase (EC 2.7.8.6) |
| ? | AssemblyC74_contig_37 | 1 = | 0 (0.000) | intergenic (–/‑435) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_27 | 7574 = | 511 (0.950) | 515 (0.680) | 88/228 | 0.5 | 68.7% | coding (551/705 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) |
| ? | AssemblyC74_contig_37 | 11 = | 0 (0.000) | intergenic (–/‑425) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_27 | = 7726 | 0 (0.000) | 499 (0.660) +CG |
89/244 | 0.7 | 100% | coding (703/705 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) |
| ? | AssemblyC74_contig_41 | = 1330 | 0 (0.000) | coding (1/411 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) | |||||
| * | ? | AssemblyC74_contig_27 | = 7728 | 0 (0.000) | 430 (0.560) | 85/248 | 1.0 | 100% | coding (705/705 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) |
| ? | AssemblyC74_contig_41 | = 1330 | 0 (0.000) | coding (1/411 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) | |||||
| * | ? | AssemblyC74_contig_28 | 1 = | 0 (0.000) | 598 (0.510) | 107/248 | 0.3 | 100% | intergenic (–/‑81) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– | |||||
| * | ? | AssemblyC74_contig_28 | = 5975 | 0 (0.000) | 548 (1.040) | 102/248 | 0.2 | 66.8% | intergenic (+36/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | YoeB toxin protein/– |
| ? | AssemblyC74_contig_30 | = 330 | 546 (1.100) | intergenic (+78/+111) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_29 | 1 = | 0 (0.000) | 192 (0.580) | 50/248 | 2.1 | 74.4% | coding (843/843 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Agmatine deiminase (EC 3.5.3.12) |
| ? | AssemblyC74_contig_34 | 2046 = | 132 (0.420) | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– | |||||
| * | ? | AssemblyC74_contig_29 | = 4892 | 0 (0.000) | 266 (0.780) | 57/242 | 1.9 | 63.0% | intergenic (‑397/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | ABC‑type antimicrobial peptide transport system, permease component/– |
| ? | AssemblyC74_contig_8 | = 1721 | 312 (0.900) | intergenic (+1/+137) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_annotation_tool=annotate_proteins_si milarity | tRNA‑Asn‑GTT/FIG00629206: hypothetical protein | |||||
| * | ? | AssemblyC74_contig_3 | 1 = | 0 (0.000) | 261 (0.590) | 78/248 | 0.4 | 100% | intergenic (–/‑221) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Universal stress protein family |
| ? | AssemblyC74_contig_50 | 1 = | 0 (0.000) | intergenic (–/‑113) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Aggregation promoting factor | |||||
| * | ? | AssemblyC74_contig_3 | = 255127 | 0 (0.000) | 281 (0.270) | 74/248 | 0.5 | 100% | intergenic (‑345/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– | |||||
| * | ? | AssemblyC74_contig_30 | = 330 | 546 (1.100) | 508 (0.980) | 109/248 | 0.1 | 65.0% | intergenic (+78/+111) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein/hypothetical protein |
| ? | AssemblyC74_contig_36 | = 1754 | 0 (0.000) | intergenic (+133/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_31 | 1 = | 0 (0.000) | 1321 (0.540) +AGTGT |
143/238 | 0.6 | 100% | intergenic (–/‑269) | –/rasttk_feature_creation_tool=RNA_reps_LSU_rRNA | –/LSU rRNA ## 23S rRNA, large subunit ribosomal RNA |
| ? | AssemblyC74_contig_39 | 1 = | 0 (0.000) | intergenic (–/+65) | –/rasttk_feature_creation_tool=RNA_reps_SSU_rRNA | –/SSU rRNA ## 16S rRNA, small subunit ribosomal RNA | |||||
| * | ? | AssemblyC74_contig_31 | 1 = | 0 (0.000) | 523 (0.400) +TTTAACAACTAATGTTGTT |
77/210 | 0.0 | 72.2% | intergenic (–/‑269) | –/rasttk_feature_creation_tool=RNA_reps_LSU_rRNA | –/LSU rRNA ## 23S rRNA, large subunit ribosomal RNA |
| ? | AssemblyC74_contig_63 | = 176 | 476 (0.790) | intergenic (+2/‑26) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE | tRNA‑Ala‑TGC/tRNA‑Met‑CAT | |||||
| * | ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | 302 (0.310) +40 bp |
62/168 | 0.4 | 100% | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation |
| ? | AssemblyC74_contig_5 | = 185954 | 0 (0.000) | intergenic (‑299/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Cof protein:HAD‑superfamily hydrolase, subfamily IIB/– | |||||
| * | ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | 962 (0.550) | 133/248 | 0.1 | 100% | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation |
| ? | AssemblyC74_contig_54 | 1 = | 0 (0.000) | intergenic (–/‑13) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Val‑TAC | |||||
| * | ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | 511 (0.380) +TGATGTT |
89/234 | 0.2 | 78.6% | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation |
| ? | AssemblyC74_contig_8 | 1645 = | 295 (0.830) | intergenic (‑212/‑2) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE | tRNA‑Thr‑GGT/tRNA‑Asn‑GTT | |||||
| * | ? | AssemblyC74_contig_32 | 1 = | 0 (0.000) | 306 (0.740) +C |
62/246 | 1.2 | 100% | intergenic (–/+1197) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Programmed cell death toxin MazF |
| ? | AssemblyC74_contig_40 | = 62 | NA (NA) | intergenic (–/+119) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Cold shock protein of CSP family | |||||
| * | ? | AssemblyC74_contig_32 | = 3311 | 0 (0.000) | 569 (0.870) | 97/248 | 0.4 | 100% | intergenic (+202/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_53 | = 622 | 0 (0.000) | coding (1/498 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_33 | 1 = | 0 (0.000) | 265 (0.530) | 86/248 | 0.5 | 100% | coding (1/972 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_8 | = 115683 | 0 (0.000) | coding (1791/1791 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Phage capsid and scaffold | |||||
| * | ? | AssemblyC74_contig_33 | = 3075 | 0 (0.000) | 326 (0.700) | 96/248 | 0.1 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_4 | 1 = | 0 (0.000) | intergenic (–/‑2) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Phage lysin, N‑acetylmuramoyl‑L‑alanine amidase (EC 3.5.1.28) | |||||
| * | ? | AssemblyC74_contig_33 | = 3075 | 0 (0.000) | 342 (0.700) | 84/248 | 0.5 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_6 | 1 = | 0 (0.000) | intergenic (–/‑63) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_34 | 1 = | 0 (0.000) | 271 (0.580) | 87/248 | 0.0 | 100% | intergenic (–/+363) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Leu‑CAG |
| ? | AssemblyC74_contig_50 | = 745 | 0 (0.000) | intergenic (+8/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Aggregation promoting factor/– | |||||
| * | ? | AssemblyC74_contig_34 | 2046 = | 132 (0.420) | 285 (0.710) +T |
57/246 | 1.3 | 81.3% | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– |
| ? | AssemblyC74_contig_35 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Co‑activator of prophage gene expression IbrA | |||||
| * | ? | AssemblyC74_contig_34 | 2046 = | 132 (0.420) | 306 (0.530) | 53/248 | 1.8 | 82.3% | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– |
| ? | AssemblyC74_contig_52 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Putative transposase InsK for insertion sequence element IS150 | |||||
| * | ? | AssemblyC74_contig_34 | 2046 = | 132 (0.420) | 301 (0.820) +T |
51/246 | 1.9 | 82.1% | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– |
| ? | AssemblyC74_contig_56 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Co‑activator of prophage gene expression IbrA | |||||
| * | ? | AssemblyC74_contig_34 | = 2107 | 0 (0.000) | 2704 (1.430) | 135/248 | 0.0 | 100% | intergenic (‑284/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– |
| ? | AssemblyC74_contig_42 | = 1243 | 0 (0.000) | intergenic (‑13/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– | |||||
| * | ? | AssemblyC74_contig_36 | 1 = | 0 (0.000) | 536 (0.650) | 100/248 | 0.3 | 100% | intergenic (–/‑369) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_64 | = 352 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_37 | = 1750 | 0 (0.000) | 483 (0.620) +AAAAAGT |
96/234 | 1.5 | 100% | intergenic (‑2/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | FIG00632365: hypothetical protein/– |
| ? | AssemblyC74_contig_62 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_38 | = 1652 | 0 (0.000) | 239 (0.550) | 70/248 | 0.6 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_46 | = 883 | 0 (0.000) | intergenic (+235/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_38 | = 1652 | 0 (0.000) | 169 (0.390) | 68/248 | 0.1 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_59 | = 453 | 0 (0.000) | intergenic (+197/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Transposase, IS4/– | |||||
| * | ? | AssemblyC74_contig_39 | 1 = | 0 (0.000) | 370 (0.230) | 65/244 | 0.6 | 66.7% | intergenic (–/+65) | –/rasttk_feature_creation_tool=RNA_reps_SSU_rRNA | –/SSU rRNA ## 16S rRNA, small subunit ribosomal RNA |
| ? | AssemblyC74_contig_63 | 93 = | 369 (0.620) | intergenic (+11/‑9) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE | tRNA‑Pro‑TGG/tRNA‑Ala‑TGC | |||||
| * | ? | AssemblyC74_contig_40 | 1 = | 0 (0.000) | 945 (0.900) | 118/248 | 0.0 | 100% | intergenic (–/+180) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Cold shock protein of CSP family |
| ? | AssemblyC74_contig_45 | 1 = | 0 (0.000) | coding (906/906 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Integrase, catalytic region | |||||
| * | ? | AssemblyC74_contig_40 | = 1604 | 0 (0.000) | 258 (0.450) | 68/248 | 0.8 | 100% | intergenic (‑113/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_52 | = 702 | 0 (0.000) | intergenic (+23/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Putative transposase InsK for insertion sequence element IS150/– | |||||
| * | ? | AssemblyC74_contig_41 | 1 = | 0 (0.000) | 476 (0.580) | 101/248 | 0.2 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_47 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_41 | 1 = | 0 (0.000) | 654 (0.840) | 112/248 | 0.0 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_51 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Conserved domain protein | |||||
| * | ? | AssemblyC74_contig_43 | 1 = | 0 (0.000) | 621 (0.570) | 116/248 | 0.0 | 100% | coding (1215/1215 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_44 | = 1136 | 0 (0.000) | coding (1/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_43 | 971 = | 567 (0.830) | 431 (0.820) | 75/206 | 0.4 | 64.7% | coding (245/1215 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_48 | 22 = | 0 (0.000) | coding (21/843 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Chitinase (EC 3.2.1.14) | |||||
| * | ? | AssemblyC74_contig_43 | 992 = | 498 (0.730) | 1144 (1.090) | 117/248 | -0.0 | 82.1% | coding (224/1215 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_61 | = 423 | 0 (0.000) | intergenic (‑1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_43 | = 1217 | 0 (0.000) | 1882 (1.790) | 104/240 | 0.1 | 73.9% | intergenic (‑2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_44 | 617 = | 1332 (0.920) | coding (520/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_44 | 1 = | 0 (0.000) | 538 (0.540) | 98/248 | 0.6 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_65 | = 349 | 0 (0.000) | intergenic (‑1/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_44 | 1 = | 0 (0.000) | 616 (0.610) | 89/248 | 0.5 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_66 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_44 | = 810 | 1395 (0.930) | 433 (0.500) +GCACTCTTGTCACCATCAAT |
67/208 | 1.0 | 42.6% | coding (327/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_60 | = 439 | 0 (0.000) | coding (438/438 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | FIG00630508: hypothetical protein | |||||
| * | ? | AssemblyC74_contig_44 | = 1136 | 0 (0.000) | 613 (0.590) | 97/248 | 0.2 | 100% | coding (1/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_48 | = 844 | 0 (0.000) | coding (843/843 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Chitinase (EC 3.2.1.14) | |||||
| * | ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | 361 (0.340) | 94/248 | 0.1 | 100% | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– |
| ? | AssemblyC74_contig_55 | 1 = | 0 (0.000) | intergenic (–/–) | –/– | –/– | |||||
| * | ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | 397 (0.380) | 85/248 | 0.3 | 100% | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– |
| ? | AssemblyC74_contig_9 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Transcriptional regulator SpxA1 | |||||
| * | ? | AssemblyC74_contig_47 | 418 = | NA (NA) | 77 (0.080) | 7/246 | 1.8 | 100% | coding (417/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_61 | 4 = | 0 (0.000) | coding (419/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | 421 = | NA (NA) | 423 (0.730) +GCATTCATAGAA |
67/224 | 1.2 | NA | coding (420/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_47 | = 561 | NA (NA) | coding (560/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | 452 = | NA (NA) | 273 (0.590) +34 bp |
63/180 | 0.5 | NA | noncoding (7/29 nt) | direct | CRISPR repeat with sequence actatcgatgtaagtaattgggatacgtc |
| ? | AssemblyC74_contig_47 | = 882 | NA (NA) | intergenic (+2/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_47 | 452 = | NA (NA) | 571 (0.760) +34 bp |
79/180 | -0.0 | 100% | noncoding (7/29 nt) | direct | CRISPR repeat with sequence actatcgatgtaagtaattgggatacgtc |
| ? | AssemblyC74_contig_61 | 1 = | 0 (0.000) | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | 730 = | NA (NA) | 429 (0.410) | 90/248 | 0.0 | 100% | coding (729/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_61 | 1 = | 0 (0.000) | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | = 786 | NA (NA) | 252 (0.290) +AAATGTTACGAATATGAC |
50/212 | 0.0 | 41.4% | noncoding (29/29 nt) | direct | CRISPR repeat with sequence agtgtagatgtaagtaattgggatacgtc |
| ? | AssemblyC74_contig_61 | = 81 | 418 (0.290) | coding (342/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_49 | 1 = | 0 (0.000) | 350 (0.690) | 68/248 | 0.8 | 100% | intergenic (–/‑111) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein |
| ? | AssemblyC74_contig_55 | = 585 | 0 (0.000) | intergenic (–/–) | –/– | –/– | |||||
| * | ? | AssemblyC74_contig_49 | = 764 | 0 (0.000) | 188 (0.390) | 69/248 | 0.1 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– |
| ? | AssemblyC74_contig_59 | 1 = | 0 (0.000) | intergenic (–/‑31) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Transposase, IS4 | |||||
| * | ? | AssemblyC74_contig_50 | = 745 | 0 (0.000) | 298 (0.650) | 81/248 | 0.4 | 100% | intergenic (+8/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Aggregation promoting factor/– |
| ? | AssemblyC74_contig_9 | = 104617 | 0 (0.000) | intergenic (+75/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Putative deoxyribonuclease YcfH/– | |||||
| * | ? | AssemblyC74_contig_51 | = 723 | 0 (0.000) | 467 (0.470) | 85/248 | 0.0 | 68.3% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved domain protein/– |
| ? | AssemblyC74_contig_61 | = 87 | 434 (0.300) | coding (336/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_52 | 1 = | 0 (0.000) | 275 (0.340) | 76/248 | 2.1 | 100% | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Putative transposase InsK for insertion sequence element IS150 |
| ? | AssemblyC74_contig_53 | 1 = | 0 (0.000) | intergenic (–/+2) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_54 | = 611 | 0 (0.000) | 418 (0.530) | 90/248 | 0.0 | 100% | intergenic (+1/–) | rasttk_feature_creation_tool=tRNAscan‑SE/– | tRNA‑Arg‑ACG/– |
| ? | AssemblyC74_contig_63 | 1 = | 0 (0.000) | intergenic (–/‑8) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Pro‑TGG | |||||
| * | ? | AssemblyC74_contig_60 | 1 = | 0 (0.000) | 456 (0.460) | 88/248 | 0.0 | 94.7% | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/FIG00630508: hypothetical protein |
| ? | AssemblyC74_contig_61 | 22 = | 51 (0.040) | coding (401/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_61 | 22 = | 51 (0.040) | 360 (0.310) | 81/202 | 0.0 | 55.7% | coding (401/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_61 | = 99 | 531 (0.460) | coding (324/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_62 | = 391 | 0 (0.000) | 437 (0.530) | 85/248 | 1.6 | 100% | intergenic (+213/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Mobile element protein/– |
| ? | AssemblyC74_contig_64 | = 352 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_64 | 1 = | 0 (0.000) | 552 (0.690) | 92/248 | 1.1 | 100% | coding (1/351 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_65 | 1 = | 0 (0.000) | coding (348/348 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_64 | 1 = | 0 (0.000) | 536 (0.660) | 88/248 | 0.5 | 100% | coding (1/351 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_66 | = 349 | 0 (0.000) | coding (348/348 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||