| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | REL606 | 1325040 = | 47 (0.670) | 4 (0.070) +TGTTATAACA |
3/130 | 7.9 | 9.0% | intergenic (+29/‑184) | yciQ/yciL | hypothetical protein; b1268_1/23S rRNA pseudouridylate synthase |
| ? | REL606 | 1325040 = | 47 (0.670) | intergenic (+29/‑184) | yciQ/yciL | hypothetical protein; b1268_1/23S rRNA pseudouridylate synthase | |||||
| Rejected: Coverage evenness skew score above cutoff. | |||||||||||
| Rejected: Frequency below/above cutoff threshold. | |||||||||||
TATCTTTATGGTTA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < REL606/1325053‑1325040‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TAACCATAAAGATA > REL606/1325040‑1325053 |||||||||| TATCTTTATGGTTATGTTATAACATAACCATAAAGATA > 1:1300626/1‑38TATCTTTATGGTTATGTTATAACATAACCATAAAGATA > 2:1300626/1‑38 ATCTTTATGGTTATGTTATAACATAACCATAAAGAT > 2:1917597/1‑36 ATCTTTACGGTTATGTTATAACATAACCATAAAGAT < 1:1917597/36‑1 |||||||||| TATCTTTATGGTTA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < REL606/1325053‑1325040‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TAACCATAAAGATA > REL606/1325040‑1325053 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 15 ≤ ATCG/ATCG < 23 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 38 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |