| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | REL606 | 2806881 = | 67 (1.070) | 4 (0.110) +TAGAGCGTAACTGCAATGAATTGTGCCCAT |
4/90 | 5.1 | 8.1% | intergenic (+140/+93) | barA/gudD | hybrid sensory histidine kinase, in two‑component regulatory system with UvrY/(D)‑glucarate dehydratase 1 |
| ? | REL606 | = 3529112 | 85 (1.360) | intergenic (+71/+128) | yhhK/livJ | hypothetical protein/leucine/isoleucine/valine transporter subunit | |||||
| Rejected: Coverage evenness skew score above cutoff. | |||||||||||
| Rejected: Frequency below/above cutoff threshold. | |||||||||||
TACGCTTATCAGGCCTACAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < REL606/2806900‑2806881‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TTGTAGGCCTGATAAGCGTA < REL606/3529112‑3529093 |||||||||||||||||||||||||||||| TACGCTTATCAGGCCTACATTAGAGCGTAACTGCAATGAATTGTGCCCATTTGTAGGCCTGATAAGCGTA < 1:1504802/70‑1TACGCTTATCAGGCCTACATTAGAGCGTAACTGCAATGAATTGTGCCCATTTGTAGGCCTGATAAGCGTA > 2:1504802/1‑70 CAGGCCTACATTAGAGCGTAACTGCAATGAATTGTGCCCATTTGTAGGCCTG < 1:543610/52‑1 CAGGCCTACATTAGAGCGTAACTGCAATGAATTGTGCCCATTTGTAGGCCTG > 2:543610/1‑52 |||||||||||||||||||||||||||||| TACGCTTATCAGGCCTACAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < REL606/2806900‑2806881‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TTGTAGGCCTGATAAGCGTA < REL606/3529112‑3529093 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 11 ≤ ATCG/ATCG < 25 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 38 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |