Predicted mutation | ||||||
---|---|---|---|---|---|---|
evidence | seq id | position | mutation | annotation | gene | description |
JC JC | NC_000913 | 1,293,032 | IS1 (–) +8 bp | intergenic (‑110/‑488) | hns ← / → tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase |
New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | 257908 = | NA (NA) | 44 (0.850) | 37/282 | 0.4 | 100% | noncoding (768/768 nt) | IS1 | repeat region |
? | NC_000913 | = 1293039 | 0 (0.000) | intergenic (‑117/‑488) | hns/tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase | |||||
* | ? | NC_000913 | 1293032 = | 0 (0.000) | 68 (1.310) | 55/282 | 0.0 | 100% | intergenic (‑110/‑495) | hns/tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase |
? | NC_000913 | = 1979270 | NA (NA) | noncoding (1/768 nt) | IS1 | repeat region |
TTAAAAATTTGCTAAATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGT > NC_000913/257768‑257910 | ttAAAAATTTGCTAAATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACGGAGTGGGCACCCGAAGAGCAGCTTGTTCAGAAGCTTTGCTGTTGTGGGCGCGAATATTAGTGAaggtaagt > 1:50054/1‑143 (MQ=255) | TTAAAAATTTGCTAAATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGT > NC_000913/257768‑257910 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 12 ≤ ATCG/ATCG < 13 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |