New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 19785020 (0.000)8 (0.090) 7/82 9.8 100% intergenic (‑305/+16) flhD/insB‑5 DNA‑binding transcriptional dual regulator FlhD/IS1 protein InsB
?NC_000913 1979279 = 0 (0.000)intergenic (‑64/‑474) insA‑5/uspC IS1 protein InsA/universal stress protein C
Rejected: Coverage evenness skew score above cutoff.

TAATGCGTGATGCAGATCACACAAAACACTCAATTACTTAACATAAATG  >  NC_000913/1978454‑1978502
                                                |
taatGCGTGATGCAGATCACACAAAACACTCAATTACTTAACATAAATg  >  2:3672257/1‑49 (MQ=255)
                                                |
TAATGCGTGATGCAGATCACACAAAACACTCAATTACTTAACATAAATG  >  NC_000913/1978454‑1978502

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 20 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 39 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.