Predicted mutation | ||||||
---|---|---|---|---|---|---|
evidence | seq id | position | mutation | annotation | gene | description |
MC JC | NC_000913 | 3,761,993 | Δ8,250 bp | rhsA–yibV | rhsA, yibA, yibJ, yibG, yibS, yibV |
Missing coverage evidence... | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
seq id | start | end | size | ←reads | reads→ | gene | description | |||
* | * | ÷ | NC_000913 | 3761993 | 3770242 | 8250 | 30 [0] | [0] 28 | rhsA–yibV | rhsA,yibA,yibJ,yibG,yibS,yibV |
New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | = 3761992 | 0 (0.000) | 27 (1.010) | 24/96 | 0.0 | 100% | intergenic (‑37/‑191) | yibF/rhsA | glutathione transferase‑like protein YibF/rhs element protein RhsA |
? | NC_000913 | 3770243 = | 0 (0.000) | coding (1137/1137 nt) | yibH | inner membrane protein YibH |
AATTAGTCCTTACAAGGAGCAAAGTTCCATAATCTCCCCCCTCCCCCTCAATGATCCAAATAAAGATAATGCATCCAGCTGGTCATTCTTAGCAGC > NC_000913/3770196‑3770291 | cgagtttcatgccgagtcctttgtgcgaggaaaaatatcagtatggcTCa < 1:549252‑M2/3‑1 (MQ=255) agtttcatgccgagtcctttgtgcgaggaaaaatatcagtatggcTCAAt > 1:1294400‑M2/46‑50 (MQ=255) gtttcatgccgagtcctttgtgcgaggaaaaatatcagtatggcTCAATg < 1:2059098‑M2/6‑1 (MQ=255) tttcatgccgagtcctttgtgcgaggaaaaatatcagtatggcTCAATGa < 1:557987‑M2/7‑1 (MQ=255) catgccgagtcctttgtgcgaggaaaaatatcagtatggcTCAATGATc < 1:2206528‑M2/9‑1 (MQ=255) ccgagtcctttgtgcgaggaaaaatatcagtatggcTCAATGATCCaaa > 1:2063321‑M2/37‑49 (MQ=255) tcctttgtgcgaggaaaaatatcagtatggcTCAATGATCCAAATAAAGa < 1:1794103‑M2/19‑1 (MQ=255) cctttgtgcgaggaaaaatatcagtatggcTCAATGATCCAAATAAAGa > 1:810753‑M2/31‑49 (MQ=255) ttgtgcgaggaaaaatatcagtatggcTCAATGATCCAAATAAAGATAAt > 1:1285583‑M2/28‑50 (MQ=255) tgtgcgaggaaaaatatcagtatggcTCAATGATCCAAATAAAGATaa < 1:1899321‑M2/22‑1 (MQ=255) tgtgcgaggaaaaatatcagtatggcTCAATGATCCAAATAAAGATaa < 1:506609‑M2/22‑1 (MQ=255) tgtgcgaggaaaaatatcagtatggcTCAATGATCCAAATAAAGATAAt < 1:1182548‑M2/23‑1 (MQ=255) tgtgcgaggaaaaatatcagtatggcTCAATGATCCAAATAAAGATAATg > 1:1581449‑M2/27‑50 (MQ=255) gtgcgaggaaaaatatcagtatggcTCAATGATCCAAATAAAGATAATg > 1:882813‑M2/26‑49 (MQ=255) gtgcgaggaaaaatatcagtatggcTCAATGATCCAAATAAAGATAATg < 1:543276‑M2/24‑1 (MQ=255) tgcgaggaaaaatatcattatggcTCAATGATCCAAATAAAGATAATGc < 1:2006149‑M2/25‑1 (MQ=255) cgaggaaaaatatcagtatggcTCAATGATCCAAATAAAGATAATGCATc > 1:921926‑M2/23‑50 (MQ=255) gaggaaaaatatcagtatggcTCAATGATCCAAATAAAGATAATGCATcc < 1:2240814‑M2/29‑1 (MQ=255) gaggaaaaatatcagtatggcTCAATGATCCAAATAAAGATAATGCATc > 1:2149361‑M2/22‑49 (MQ=255) gaaaaatatcagtatggcTCAATGATCCAAATAAAGATAATGCATCCAGc < 1:483139‑M2/32‑1 (MQ=255) aaaatatcagtatggcTCAATGATCCAAATAAAGATAATGCATCCAGCTg > 1:73874‑M2/17‑50 (MQ=255) aaaatatcagtatggcTCAATGATCCAAATAAAGATAATGCATCCAGCTg > 1:1046361‑M2/17‑50 (MQ=255) aaatatcagtatggcTCAATGATCCAAATAAAGATAATGCATCCAGCTgg > 1:939073‑M2/16‑50 (MQ=255) tatggcTCAATGATCCAAATAAAGATAATGCATCCAGCTGGTCATTCt > 1:1013834‑M2/7‑48 (MQ=255) tggcTCAATGATCCAAATAAAGATAATGCATCCAGCTGGTCATTCTTag > 1:2045536‑M2/5‑49 (MQ=255) tggcTCAATGATCCAAATAAAGATAATGCATCCAGCTGGTCATTCTTag > 1:1903057‑M2/5‑49 (MQ=255) gcTCAATGATCCAAATAAAGATAATGCATCCAGCTGGTCATTCTTagca < 1:90885‑M2/47‑1 (MQ=255) cTCAATGATCCAAATAAAGATAATGCATCCAGCTGGTCATTCTTagcagc < 1:323495‑M2/49‑1 (MQ=255) | AATTAGTCCTTACAAGGAGCAAAGTTCCATAATCTCCCCCCTCCCCCTCAATGATCCAAATAAAGATAATGCATCCAGCTGGTCATTCTTAGCAGC > NC_000913/3770196‑3770291 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 29 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 39 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |