| Predicted mutation | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| MC JC | NC_000913 | 687,860 | Δ1,185 bp | IS5‑mediated | insH‑3 | insH‑3 |
| Missing coverage evidence... | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 687860 | 689044 | 1185 | 25 [0] | [0] 27 | insH‑3 | insH‑3 |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 687859 | 0 (0.000) | 24 (0.890) | 22/94 | 0.1 | 100% | noncoding (1187/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 689045 = | 0 (0.000) | noncoding (1/1195 nt) | IS5 | repeat region | |||||
CTCCAGATGACAAACATGATCTCATATCAGGGACTTGTTCGCACCTTCCTTAGGTAACATTTAGTTTGGCTAAATGTAAAGATATTGCTGTTTTATT > NC_000913/688997‑689093 | atcgtctgcaactttattgtgcagtgttgtgcctgttagggaaggtgcc > 1:1612562‑M2/49‑49 (MQ=255) cgtctgcaactttattgtgcagtgttgtgcctgttagggaaggtgcCt > 1:1600878‑M2/47‑48 (MQ=255) gtctgcaactttattgtgcagtgttgtgcctgttagggaaggtgcCtt < 1:573909‑M2/3‑1 (MQ=255) gtctgcaactttattgtgcagtgttgtgcctgttagggaaggtgcCtt < 1:1276929‑M2/3‑1 (MQ=255) gtctgcaactttattgtgcagtgttgtgcctgttagggaaggtgcCt > 1:489746‑M2/46‑47 (MQ=255) gtctgcaactttattgtgcagtgttgtgcctgttagggaaggtgcCTTa < 1:1095482‑M2/4‑1 (MQ=255) tctgcaactttattgtgcagtgttgtgcctgttagggaaggtgcCTTAg < 1:1177861‑M2/5‑1 (MQ=255) ctgcaactttattgtgcagtgttgtgcctgttagggaaggtgcCTTAgg > 1:585098‑M2/44‑49 (MQ=255) ctgcaactttattgtgcagtgttgtgcctgttagggaaggtgcCTTAgg > 1:1992725‑M2/44‑49 (MQ=255) tgcaactttattgtgcagtgttgtgcctgttagggaaggtgcCTTAgg > 1:213373‑M2/43‑48 (MQ=255) tattgtgcagtgttgtgcctgttagggaaggtgcCTTAGGTAACAttt < 1:687488‑M2/14‑1 (MQ=255) tgcagtgttgtgcctgttagggaaggtgcCTTAGGTAACATTTAGTTTg < 1:1026648‑M2/20‑1 (MQ=255) cagtgttgtgcctgttagggaaggtgcCTTAGGTAACATTTAGTTTGGc > 1:624456‑M2/28‑49 (MQ=255) agtgttgtgcctgttagggaaggtgcCTTAGGTAACATTTAGTTTGGc > 1:418699‑M2/27‑48 (MQ=255) tgttgtgcctgttagggaaggtgcCTTAGGTAACATTTAGTTTGGCTa > 1:1132030‑M2/25‑48 (MQ=255) tgcctgttagggaaggtgcCTTAGGTAACATTTAGTTTGGCTAAATGTa < 1:866641‑M2/30‑1 (MQ=255) gcctgttagggaaggtgcCTTAGGTAACATTTAGTTTGGCTAAATGTa > 1:1871609‑M2/19‑48 (MQ=255) ctgttagggaaggtgcCTTAGGTAACATTTAGTTTGGCTAAATGTAAAg < 1:1679333‑M2/33‑1 (MQ=255) tgttagggaaggtgcCTTAGGTAACATTTAGTTTGGCTAAATGTa > 1:1071217‑M2/16‑45 (MQ=255) gttagggaaggtgcCTTAGGTAACATTTAGTTTGGCTAAATGTAAAGa > 1:836117‑M2/15‑48 (MQ=255) ttagggaaggtgcCTTAGGTAACATTTAGTTTGGCTAAATGTAAAGa < 1:1907091‑M2/34‑1 (MQ=255) gaaggtgcCTTAGGTAACATTTAGTTTGGCTAAATGTAAAGATATTGCt < 1:87629‑M2/41‑1 (MQ=255) aaggtgcCTTAGGTAACATTTAGTTTGGCTAAATGTAAAGATATTGCTg < 1:1097195‑M2/42‑1 (MQ=255) aggtgcCTTAGGTAACATTTAGTTTGGCTAAATGTAAAGATATTGCTGt > 1:1535515‑M2/7‑49 (MQ=255) cttAGGTAACATTTAGTTTGGCTAAATGTAAAGATATTGCTGTTTTAtt > 1:16088/1‑49 (MQ=255) cttAGGTAACATTTAGTTTGGCTAAATGTAAAGATATTGCTGTTTTAtt < 1:759566/49‑1 (MQ=255) cttAGGTAACATTTAGTTTGGCTAAATGTAAAGATATTGCTGTTTTAtt > 1:955069/1‑49 (MQ=255) | CTCCAGATGACAAACATGATCTCATATCAGGGACTTGTTCGCACCTTCCTTAGGTAACATTTAGTTTGGCTAAATGTAAAGATATTGCTGTTTTATT > NC_000913/688997‑689093 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 39 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |