Predicted mutation | |||||||
---|---|---|---|---|---|---|---|
evidence | seq id | position | mutation | freq | annotation | gene | description |
JC JC | NC_000913 | 1,293,015 | IS1 (+) +8 bp | 44.6% | intergenic (‑93/‑505) | hns ← / → tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase |
New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | 257908 = | NA (NA) | 54 (0.460) | 45/260 | NT | 46.2% | noncoding (768/768 nt) | IS1 | repeat region |
? | NC_000913 | 1293015 = | 59 (0.540) | intergenic (‑93/‑512) | hns/tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase | |||||
* | ? | NC_000913 | = 258675 | NA (NA) | 41 (0.350) | 35/260 | NT | 39.5% | noncoding (1/768 nt) | IS1 | repeat region |
? | NC_000913 | = 1293022 | 59 (0.540) | intergenic (‑100/‑505) | hns/tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase |
TTAAAAATTTGCTAAATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGAC > NC_000913/257768‑257916 | ttAAAAATTTGCTAAATTTTGCCAATTTGATAAAACAGGTGCATAACAACAGGAGCTAGCAATGACGTTACCGAGTGGACACCATAAGAGCAGATTGATCAAAAAAATTACCGCACTACGCCCGTATAATCGCGAaggtaagtgcaaag > 2:969847/1‑143 (MQ=255) | TTAAAAATTTGCTAAATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGAC > NC_000913/257768‑257916 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 15 ≤ ATCG/ATCG < 16 ≤ ATCG/ATCG < 35 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |