New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 610152 =NA (NA)3 (0.020)
+AATTTTCGTAG
3/156 NT NA noncoding (36/98 nt) RIP54 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP54 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
?NC_000913 = 3706060 NA (NA)noncoding (98/98 nt) RIP266 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP266 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site

TTCATGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACAAAAATCTTGCCAATTCAATATATTGCAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  NC_000913/610219‑610152
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GCCTGATGCGCTCCGCTTATCAGGCC  <  NC_000913/3706060‑3706035
                                                                    |||||||||||                          
TTCATGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACAAAAATCTTGCCAATTCAATATATTGCAGGACCATGTAGGCCTGATGCGCTACGCTTATCA      <  1:1615250/100‑1
    TGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACAAAAATCTTGCCAATTCAATATATTGCAGGACCATGTAGGCCTGATGCGCTACGCTTATCAGGCC  <  2:3301643/100‑1
    TGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACAAAAATCTTGCCAATTCAATATATTGCAGGACCATGTAGGCCTGATGCGCTACGCTTATCAGGC   <  1:2676873/99‑1
                                                                    |||||||||||                          
TTCATGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACAAAAATCTTGCCAATTCAATATATTGCAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  NC_000913/610219‑610152
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GCCTGATGCGCTCCGCTTATCAGGCC  <  NC_000913/3706060‑3706035

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 12 ≤ ATCG/ATCG < 22 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.