New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 416834112 (0.130)9 (0.110) 7/158 NT 45.8% intergenic (+141/‑31) rrsB/gltT 16S ribosomal RNA of rrnB operon/tRNA‑Glu
?NC_000913 = 4168363 NA (NA)intergenic (+163/‑9) rrsB/gltT 16S ribosomal RNA of rrnB operon/tRNA‑Glu

TCACGCAACGCGTGATAAGCAATTTTCGTGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACAGGGG‑TTCGAATCCCCTAGGGGAC  >  NC_000913/4168343‑4168443
                    |                                                                                 
tCACGCAACGCGTGATAAGCAATTTTCGTGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACAGGGGATTCGAA‑CCCCtgttacc   <  2:2383198/100‑7 (MQ=1)
 cACGCAACGCGTGATAAGCAATTTTCGTGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACAGGGGATTCGAA‑CCCCtgttaccg  <  1:1564570/100‑8 (MQ=1)
                    |                                                                                 
TCACGCAACGCGTGATAAGCAATTTTCGTGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACAGGGG‑TTCGAATCCCCTAGGGGAC  >  NC_000913/4168343‑4168443

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 27 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.