New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 3470277 =NA (NA)7 (0.070) 4/164 NT NA coding (1053/1185 nt) tufA translation elongation factor EF‑Tu 1
?NC_000913 3470311 = NA (NA)coding (1019/1185 nt) tufA translation elongation factor EF‑Tu 1

GATCGGGTGGATCAGGGTAACAACCATTTTGATGTTGTCGCCCGGCATTACCATCTCTACGCCTTCCGGCAGTTCGATGGTACCAGTCACGTCAGTAGTA  >  NC_000913/3470229‑3470328
                                                |                                                   
gaccGGGTGGATCAGGGTAACAACCATTTTGATGTTGCCGCCCGGCATTACCATCACCACCCCTTCCCGCCGATCGATGGTACCAGTCCCGTCAgtagta  >  1:651507/4‑100 (MQ=1)
                                                |                                                   
GATCGGGTGGATCAGGGTAACAACCATTTTGATGTTGTCGCCCGGCATTACCATCTCTACGCCTTCCGGCAGTTCGATGGTACCAGTCACGTCAGTAGTA  >  NC_000913/3470229‑3470328

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 12 ≤ ATCG/ATCG < 13 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.