New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	NC_000913	3470277 =	NA (NA)	7 (0.070)	4/164	NT	NA	coding (1053/1185 nt)	tufA	translation elongation factor EF‑Tu 1
	?	NC_000913	3470311 =	NA (NA)					coding (1019/1185 nt)	tufA	translation elongation factor EF‑Tu 1

GATCGGGTGGATCAGGGTAACAACCATTTTGATGTTGTCGCCCGGCATTACCATCTCTACGCCTTCCGGCAGTTCGATGGTACCAGTCACGTCAGTAGTA  >  NC_000913/3470229‑3470328                                                                                   |                  gaccGGGTGGATCAGGGTAACAACCATTTTGATGTTGCCGCCCGGCATTACCATCACCACCCCTTCCCGCCGATCGATGGTACCAGTCCCGTCAgtagta  >  1:651507/4‑100 (MQ=1)                                                                                   |                  GATCGGGTGGATCAGGGTAACAACCATTTTGATGTTGTCGCCCGGCATTACCATCTCTACGCCTTCCGGCAGTTCGATGGTACCAGTCACGTCAGTAGTA  >  NC_000913/3470229‑3470328

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 12 ≤ ATCG/ATCG < 13 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.