New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? minE 122444 =39 (0.640)6 (0.120)
+GGTAGAGTAC
3/78 NT 9.3% coding (622/1551 nt) cueO multicopper oxidase (laccase)
?minE = 2498641 109 (1.780)coding (1181/1689 nt) ilvB acetolactate synthase I, large subunit

ATCGCCAAACCAGCC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  minE/122458‑122444
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TGCTGACCAACGT  <  minE/2498641‑2498629
               ||||||||||             
ATCGCCAAACCAGCCGGTAGAGTACTGCTGACCAACGT  <  1:136032/38‑1
ATCGCCAAACCAGCCGGTAGAGTACTGCTGACCAA     >  1:489398/1‑35
 TCGCCAAACCAGCCGGTAGAGTACTGCTGACCAACGT  <  1:1344438/37‑1
 TCGCCAAACCAGCCGGTAGAGTACTGCTGACCAACGT  <  1:160866/37‑1
 TCGCCAAACCAGCCGGTAGAGTACTGCTGACCAACGT  <  1:4045669/37‑1
 TCGCCAAACCAGCCGGTAGAGTACTGCTGACCAACGT  >  1:5553900/1‑37
               ||||||||||             
ATCGCCAAACCAGCC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  minE/122458‑122444
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TGCTGACCAACGT  <  minE/2498641‑2498629

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.