| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | minE | = 662721 | 86 (1.400) | 4 (0.080) +TCTCGGCA |
3/82 | NT | 5.8% | coding (71/543 nt) | ycbW | hypothetical protein |
| ? | minE | 2124983 = | 71 (1.160) | coding (20/444 nt) | yhbP | conserved hypothetical protein | |||||
ATGATGCTCGATTT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > minE/662708‑662721‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGGCGATGAGTGTTTCC > minE/2124983‑2125000 |||||||| ATGATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTC < 1:600848/39‑1 TGATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTCC < 1:2802734/39‑1 TGATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTCC < 1:4139731/39‑1 GATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTC > 1:5187417/1‑37 |||||||| ATGATGCTCGATTT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > minE/662708‑662721‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGGCGATGAGTGTTTCC > minE/2124983‑2125000 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |