New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	minE	1435980 =	60 (1.160)	5 (0.130) +TGTGGTGGTGGC	4/78	NT	8.1%	coding (188/1644 nt)	yojI	fused predicted multidrug transport subunits and membrane component and ATP‑binding component of ABC superfamily
	?	minE	= 2059288	88 (1.700)					coding (552/1464 nt)	ygjE	predicted tartrate:succinate antiporter

ATTGCTGCTGTTGATGGC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  minE/1435997‑1435980 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GCTGTCGTTTGGTTGTGAT  <  minE/2059288‑2059270                   ||||||||||||                    cgTGCTGCTGTTGATGGCTGTGGTGGTGGCGCTGTCGTTTGGTCGT     <  1:1775089/44‑1   TGCTGCTGTTGATGGCTGTGGTGGTGGCGCTGTCGTTTGGTCGTGA   >  1:1624142/1‑46   TGCTGCTGTTGATGGCTGTGGTGGTGGCGCTGTCGTTTGG         <  1:561136/40‑1    GCTGCTGTTGATGGCTGTGGTGGTGGCGCTGTCGTTTGGTCGTG    <  1:1302651/44‑1      TGCTGTTGATGGCTGTGGTGGTGGCGCTGTCGTTTGGTCGTGAT  >  1:1757071/1‑44                   ||||||||||||                    ATTGCTGCTGTTGATGGC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  minE/1435997‑1435980 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GCTGTCGTTTGGTTGTGAT  <  minE/2059288‑2059270

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.