New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	minE	= 206326	NA (NA)	6 (0.110)	3/92	NT	NA	noncoding (1743/2904 nt)	rrlH	23S ribosomal RNA
	?	minE	= 206343	NA (NA)					noncoding (1760/2904 nt)	rrlH	23S ribosomal RNA

ACGCTGATATGTAGGTGAAGCGACTTGCTCGTGGAGCTGAAATCAGTCGAAGATACCAGCT  >  minE/206288‑206348                                                        |      actcTGATATGTAGGTGAAGCGACTTGCTCGTGGAGCTGAAATCAGTCGAAGATACCAgct  <  1:2743800/58‑1 (MQ=1)                                                        |      ACGCTGATATGTAGGTGAAGCGACTTGCTCGTGGAGCTGAAATCAGTCGAAGATACCAGCT  >  minE/206288‑206348

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.