| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | W3110S.gb | = 154878 | 46 (1.000) | 8 (0.230) +GTTTTGGTTTC |
4/74 | NT | 19.8% | coding (549/2598 nt) | htrE | predicted outer membrane usher protein |
| ? | W3110S.gb | 3275776 = | 38 (0.830) | coding (640/1572 nt) | garD | (D)‑galactarate dehydrogenase | |||||
CTATGATATCCGTTG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > W3110S.gb/154864‑154878‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GGTTGTGAAAAGTTGC > W3110S.gb/3275776‑3275791 ||||||||||| gTATGATATCCGTTGGTTTTGGTTTCGGTTGTGAA < 1:832716/34‑1 TATGATATCCGTTGGTTTTGGTTTCGGTTGTGAAAAGTTtt > 1:4064371/1‑39 TATGATATCCGTTGGTTTTGGTTTCGGTTGTGAAAAGTT < 1:1267724/39‑1 TATGATATCCGTTGGTTTTGGTTTCGGTTGTGAAAAGT < 1:3262988/38‑1 ATGATATCCGTTGGTTTTGGTTTCGGTTGTGAAAAGTTtt > 1:717061/1‑38 ATGATATCCGTTGGTTTTGGTTTCGGTTGTGAAAA > 1:1330230/1‑35 GATATCCGTTGGTTTTGGTTTCGGTTGTGAAAAGT < 1:1338579/35‑1 ATATCCGTTGGTTTTGGTTTCGGTTGTGAAAAGTT > 1:2450338/1‑35 ||||||||||| CTATGATATCCGTTG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > W3110S.gb/154864‑154878‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GGTTGTGAAAAGTTGC > W3110S.gb/3275776‑3275791 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |