| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | W3110S.gb | = 1651231 | 39 (0.850) | 4 (0.100) +GGACAA |
3/84 | NT | 12.0% | intergenic (+476/‑92) | ydfC/dicB | hypothetical protein/cell division inhibition protein |
| ? | W3110S.gb | = 2993865 | 28 (0.610) | intergenic (‑117/+105) | ygeL/ygeM | hypothetical protein/hypothetical protein | |||||
GTGTTATGGGTGGA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > W3110S.gb/1651218‑1651231‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TTTTAATTATATTTCA < W3110S.gb/2993865‑2993850 |||||| GTGTTATGGGTGGAGGACAATTTTTATTATATTTCA > 1:1333722/1‑36GTGTTATGGGTGGAGGACAATTTTTATTATATTTCA > 1:3768343/1‑36GTGTTATGGGTGGAGGACAATTTTTATTATATTTC < 1:110047/35‑1 TGTTATGGGTGGAGGACAATTTTTATTATATTTCA > 1:3081454/1‑35 |||||| GTGTTATGGGTGGA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > W3110S.gb/1651218‑1651231‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TTTTAATTATATTTCA < W3110S.gb/2993865‑2993850 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |