New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	W3110S.gb	= 2401919	50 (1.030)	8 (0.200) +GGCATTTCA	3/82	NT	14.5%	coding (194/978 nt)	nuoH	NADH:ubiquinone oxidoreductase, membrane subunit H
	?	W3110S.gb	= 2562879	65 (1.330)					coding (1247/1362 nt)	eutB	ethanolamine ammonia‑lyase, large subunit, heavy chain

TTAAAGAACATTTTGA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  W3110S.gb/2401904‑2401919 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GTCAGTTACTCAAC  <  W3110S.gb/2562879‑2562866                 |||||||||               gTAAAGAACATTTTGAGGCATTTCAGTCAGTTACTCAA   >  1:2924440/2‑38 gTAAAGAACATTTTGAGGCATTTCAGTCAGTTACTC     <  1:3060155/35‑1  TAAAGAACATTTTGAGGCATTTCAGTCAGTTACTCAAt  >  1:3921216/1‑37  TAAAGAACATTTTGAGGCATTTCAGTCAGTTACTCAA   <  1:250070/37‑1  TAAAGAACATTTTGAGGCATTTCAGTCAGTTACTCA    <  1:3664334/36‑1   AAAGAACATTTTGAGGCATTTCAGTCAGTTACTCAAt  >  1:1193120/1‑36   AAAGAACATTTTGAGGCATTTCAGTCAGTTACTCAA   >  1:289253/1‑36    AAGAACATTTTGAGGCATTTCAGTCAGTTACTCAAt  >  1:3643587/1‑35                 |||||||||               TTAAAGAACATTTTGA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  W3110S.gb/2401904‑2401919 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GTCAGTTACTCAAC  <  W3110S.gb/2562879‑2562866

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.