| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | W3110S.gb | = 2401919 | 22 (0.570) | 4 (0.130) +GGCATTTCA |
3/82 | NT | 10.1% | coding (194/978 nt) | nuoH | NADH:ubiquinone oxidoreductase, membrane subunit H |
| ? | W3110S.gb | = 2562879 | 65 (1.690) | coding (1247/1362 nt) | eutB | ethanolamine ammonia‑lyase, large subunit, heavy chain | |||||
TAAAGAACATTTTGA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > W3110S.gb/2401905‑2401919‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GTCAGTTACTCAA < W3110S.gb/2562879‑2562867 ||||||||| TAAAGAACATTTTGAGGCATTTCAGTCAGTTACTCAA < 1:3455652/37‑1TAAAGAACATTTTGAGGCATTTCAGTCAGTTACTCA < 1:2987334/36‑1TAAAGAACATTTTGAGGCATTTCAGTCAGTTACTCA < 1:3460656/36‑1 AAAGAACATTTTGAGGCATTTCAGTCAGTTACTCAA > 1:2369496/1‑36 ||||||||| TAAAGAACATTTTGA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > W3110S.gb/2401905‑2401919‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GTCAGTTACTCAA < W3110S.gb/2562879‑2562867 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 27 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |