New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? AP009048 3459685 =NA (NA)6 (0.090) 4/84 NT NA coding (1053/1185 nt) tufB protein chain elongation factor EF‑Tu
?AP009048 3459719 = NA (NA)coding (1019/1185 nt) tufB protein chain elongation factor EF‑Tu

CGCCTTCCGGCAGTTCGATGGTACCAGTCACGTCAGTAGTACGGAAGTAGAACTGCGGACGGTAGCCTTT  >  AP009048/3459696‑3459765
                       |                                              
cggcTTCCGGCAGTTCGATGGTACCAGTCACGTCAGTAGTACGGAAGTAGAACTGCGGACGGTAGCCttt  >  1:4052551/4‑70 (MQ=1)
                       |                                              
CGCCTTCCGGCAGTTCGATGGTACCAGTCACGTCAGTAGTACGGAAGTAGAACTGCGGACGGTAGCCTTT  >  AP009048/3459696‑3459765

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.