New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? AP009048 270848 =NA (NA)5 (0.090) 4/92 NT NA coding (1022/1152 nt) insI IS30 transposase
?AP009048 270875 = NA (NA)coding (1049/1152 nt) insI IS30 transposase

TACAAATGGGCTAATTCGGCAGTACTTTCCTAAAAAGACATGTCTTGCCCAATATACTCAACATGAACTAG  >  AP009048/270810‑270880
                                                                 |     
tACAAATGGGCTAATTCGGCAGTACTTTCCTAAAAAGACATGTCTTGCCCAATATACTCAACATGAACTAg  <  1:5081010/71‑1 (MQ=31)
                                                                 |     
TACAAATGGGCTAATTCGGCAGTACTTTCCTAAAAAGACATGTCTTGCCCAATATACTCAACATGAACTAG  >  AP009048/270810‑270880

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.