| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | CP009273 | 4034088 = | NA (NA) | 16 (0.040) | 7/94 | NT | 100% | intergenic (+92/+178) | rrfA/mobB | 5S ribosomal RNA of rrnA operon/molybdopterin‑guanine dinucleotide biosynthesis protein B |
| ? | CP009273 | 4034093 = | 0 (0.000) | intergenic (+97/+173) | rrfA/mobB | 5S ribosomal RNA of rrnA operon/molybdopterin‑guanine dinucleotide biosynthesis protein B | |||||
GAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCC > CP009273/4034021‑4034088 |gAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATccgcc > 1:9089268/1‑68 (MQ=31) |GAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCC > CP009273/4034021‑4034088 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |