![]() |
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| MC JC | 257,908 | Δ776 bp | [crl] | [crl] | |
| RA | 264,098 | G→T | L50L (CTC→CTA) | ykfH ← | uncharacterized protein |
| RA | 389,925 | (T)6→7 | intergenic (‑198/‑326) | hemB ← / → yaiT | 5‑aminolevulinate dehydratase (porphobilinogen synthase)/pseudogene, autotransporter family;putative structure; Not classified; interrupted by IS3; putative flagellin structural protein |
| RA | 482,230 | G→A | P725L (CCG→CTG) | acrB ← | multidrug efflux system protein |
| RA | 1,158,559 | C→T | Q231* (CAG→TAG) | ptsG → | fused glucose‑specific PTS enzymes: IIB component/IIC component |
| RA | 1,197,502 | C→T | G11R (GGA→AGA) | ymfD ← | e14 prophage; putative SAM‑dependent methyltransferase |
| RA | 1,544,022 | C→A | L13F (TTG→TTT) | narU ← | nitrate/nitrite transporter |
| RA | 1,726,165 | A→G | Y48C (TAC→TGC) | nemR → | transcriptional repressor for the nemRA‑gloA operon, quinone‑, glyoxal‑, and HOCl‑activated |
| RA | 1,774,576 | G→A | G263E (GGG→GAG) | ydiB → | quinate/shikimate 5‑dehydrogenase, NAD(P)‑binding |
| MC JC | 1,978,503 | Δ776 bp | insB1–insA | insB1, insA | |
| RA | 2,106,741 | A→T | S162S (TCT→TCA) | wbbH ← | O‑antigen polymerase |
| RA | 2,173,363 | Δ2 bp | intergenic (‑1/+1) | gatC ← / ← gatC | pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC |
| RA | 2,679,525 | G→T | A1074D (GCT→GAT) | yphG ← | DUF4380 domain‑containing TPR repeat protein |
| RA | 2,795,396 | C→A | Q382K (CAG→AAG) | gabP → | gamma‑aminobutyrate transporter |
| RA | 2,817,170 | C→A | E112* (GAA→TAA) | yqaB ← | fructose‑1‑P and 6‑phosphogluconate phosphatase |
| RA | 2,976,638 | T→G | S14A (TCA→GCA) | galR → | galactose‑inducible d‑galactose regulon transcriptional repressor; autorepressor |
| RA | 3,560,455 | +G | intergenic (‑2/+1) | glpR ← / ← glpR | pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon |
| RA | 4,183,136 | G→T | R637L (CGT→CTT) | rpoB → | RNA polymerase, beta subunit |
| RA | 4,296,363 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
| RA | 4,604,698 | C→A | A186E (GCA→GAA) | bglJ → | bgl operon transcriptional activator |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913_3_hsa_tpiA | 366300 | 366350 | 51 | 6 [5] | [4] 6 | [lacZ] | [lacZ] |
| * | * | ÷ | NC_000913_3_hsa_tpiA | 3423764–3424232 | 3424554–3424239 | 8–791 | 6 [5] | [5] 6 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913_3_hsa_tpiA | = 151518 | 25 (1.050) | 7 (0.320) | 5/264 | 2.3 | 22.5% | coding (82/597 nt) | yadK | putative fimbrial‑like adhesin protein |
| ? | NC_000913_3_hsa_tpiA | = 151522 | 25 (1.130) | coding (78/597 nt) | yadK | putative fimbrial‑like adhesin protein | |||||
| * | ? | NC_000913_3_hsa_tpiA | = 225281 | NA (NA) | 6 (0.260) | 5/274 | 2.4 | NA | noncoding (1511/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913_3_hsa_tpiA | = 225293 | NA (NA) | noncoding (1523/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913_3_hsa_tpiA | = 656828 | 13 (0.550) | 4 (0.170) | 4/280 | 2.8 | 22.3% | coding (272/561 nt) | pagP | phospholipid:lipid A palmitoyltransferase |
| ? | NC_000913_3_hsa_tpiA | = 656848 | 15 (0.640) | coding (292/561 nt) | pagP | phospholipid:lipid A palmitoyltransferase | |||||
| * | ? | NC_000913_3_hsa_tpiA | 1207790 = | 3 (0.130) | 17 (0.810) | 15/252 | 0.5 | 87.9% | coding (290/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913_3_hsa_tpiA | 1209619 = | 2 (0.100) | pseudogene (1/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||
| * | ? | NC_000913_3_hsa_tpiA | = 1207805 | 3 (0.130) | 20 (0.950) | 19/252 | 0.2 | 89.6% | coding (305/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913_3_hsa_tpiA | = 1209602 | 2 (0.100) | pseudogene (18/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||
| * | ? | NC_000913_3_hsa_tpiA | = 1299498 | 0 (0.000) | 20 (0.870) | 20/276 | 0.3 | 100% | intergenic (+253/‑1684) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein |
| ? | NC_000913_3_hsa_tpiA | 1300698 = | 0 (0.000) | intergenic (+1453/‑484) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913_3_hsa_tpiA | = 2714357 | NA (NA) | 4 (0.200) +GCGGCGTGAACGCCTTATCC |
4/244 | 2.5 | NA | noncoding (75/98 nt) | RIP188 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP188 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site |
| ? | NC_000913_3_hsa_tpiA | = 3563652 | NA (NA) | noncoding (71/98 nt) | RIP256 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP256 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||
| * | ? | NC_000913_3_hsa_tpiA | 2729955 = | NA (NA) | 4 (0.180) | 4/272 | 2.7 | NA | noncoding (1203/1542 nt) | rrsG | 16S ribosomal RNA of rrnG operon |
| ? | NC_000913_3_hsa_tpiA | 2729972 = | NA (NA) | noncoding (1186/1542 nt) | rrsG | 16S ribosomal RNA of rrnG operon | |||||