mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.29.0 revision 8f9c342918e4
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| MC JC | 257,908 | Δ776 bp | [crl] | [crl] | |
| JC | 702,444 | (GCATAACGCGCACGCCCTGTTTCATCAGCTCATCGC)1→2 | coding (308/1149 nt) | nagA ← | N‑acetylglucosamine‑6‑phosphate deacetylase |
| JC JC | 889,488 | IS1 (–) +9 bp | coding (324‑332/1686 nt) | ybjL ← | putative transporter |
| RA | 1,728,708 | A→G | N121S (AAT→AGT) | rnt → | RNase T; exoribonuclease T; structured DNA 3' exonuclease; RNA processing; DNA repair |
| MC JC | 1,978,503 | Δ776 bp | insB1–insA | insB1, insA | |
| RA | 2,173,363 | Δ2 bp | intergenic (‑1/+1) | gatC ← / ← gatC | pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC |
| RA | 2,675,452 | G→C | P104A (CCG→GCG) | yphC ← | putative Zn‑dependent NAD(P)‑binding oxidoreductase |
| RA | 2,693,818 | C→G | V576L (GTG→CTG) | purL ← | phosphoribosylformyl‑glycineamide synthetase |
| RA | 2,701,175 | G→C | L185L (CTC→CTG) | pdxJ ← | pyridoxine 5'‑phosphate synthase |
| RA | 2,713,302 | G→T | R136L (CGT→CTT) | srmB → | ATP‑dependent RNA helicase |
| RA | 2,724,590 | C→T | G386D (GGT→GAT) | kgtP ← | alpha‑ketoglutarate transporter |
| RA | 3,548,179 | G→T | A631D (GCT→GAT) | malQ ← | 4‑alpha‑glucanotransferase (amylomaltase) |
| RA | 3,560,455 | +G | intergenic (‑2/+1) | glpR ← / ← glpR | pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon |
| MC JC | 4,130,167 | Δ462 bp | coding (333‑794/2433 nt) | metL → | Bifunctional aspartokinase/homoserine dehydrogenase 2 |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 3423729–3424234 | 3424586–3424238 | 5–858 | 32 [30] | [31] 34 | [rrfD]–[rrlD] | [rrfD], [rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 71 (1.180) | 64/290 | 0.0 | 100% | intergenic (+253/‑1684) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+1453/‑484) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein | |||||