New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913_3_bme_pgi = 2597712NA (NA)4 (0.110)
+GCCTACATATCGACGATGATCAAGCTTTCCT
3/222 6.0 NA noncoding (40/46 nt) REP181 (repetitive extragenic palindromic) element; contains 2 REP sequences REP181 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913_3_bme_pgi 4235376 = NA (NA)intergenic (‑2143/‑531) lysC/yjbE lysine‑sensitive aspartokinase 3/extracellular polysaccharide production threonine‑rich protein
Rejected: Coverage evenness skew score above cutoff.

CGGATGCGGCGTGAACGCCTTATCCG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  NC_000913_3_bme_pgi/2597687‑2597712
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TCGCGCATCTGCATGCGCGAAG  >  NC_000913_3_bme_pgi/4235376‑4235397
                          |||||||||||||||||||||||||||||||                      
CGGATGCGGCGTGAACGCCTTATCCGGCCTACATATCGACGATGATCAAGCTTTCCTTCGCGCATCTGCATGCGCGAAG  <  1:279794/79‑1
CGGATGCGGCGTGAACGCCTTATCCGGCCTACATATCGACGATGATCAAGCTTTCCTTCGCGCATCTGCATGCGCGAAG  >  2:279794/1‑79
                 CCTTATCCGGCCTACATATCGACGATGATCAAGCTTTCCTTCGCGCATCTGCATGCGCGAAG  >  1:312/1‑62
                 CCTTATCCGGCCTACATATCGACGATGATCAAGCTTTCCTTCGCGCATCTGCATGCGCGAAG  <  2:312/62‑1
                          |||||||||||||||||||||||||||||||                      
CGGATGCGGCGTGAACGCCTTATCCG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  NC_000913_3_bme_pgi/2597687‑2597712
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TCGCGCATCTGCATGCGCGAAG  >  NC_000913_3_bme_pgi/4235376‑4235397

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.