mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence (highest frequency 20 of 24 shown, sorted by frequency from high to low) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | AP012306 | 1,091,992 | 0 | T | G | 44.9% | 399.6 / 90.7 | 274 | intergenic (+38/‑145) | narI/ychS | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/predicted protein |
| * | AP012306 | 1,944,288 | 0 | A | C | 35.6% | 390.0 / 73.9 | 232 | G361G (GGT→GGG) | menE | o‑succinylbenzoate‑CoA ligase |
| * | AP012306 | 935,054 | 0 | G | T | 34.2% | 143.6 / 59.6 | 73 | intergenic (+24/‑1406) | putP/ycdO | proline:sodium symporter/conserved protein |
| * | AP012306 | 3,938,887 | 0 | C | T | 34.2% | 378.7 / 179.8 | 243 | S44F (TCT→TTT) | bglJ | DNA‑binding transcriptional regulator |
| * | AP012306 | 3,372,701 | 0 | T | G | 32.9% | 138.7 / 19.9 | 79 | noncoding (54/76 nt) | gltU | tRNA‑Glu |
| * | AP012306 | 644,417 | 0 | G | A | 31.4% | 835.6 / inf | 555 | intergenic (+32/‑401) | lysQ/nadA | tRNA‑Lys/quinolinate synthase, subunit A |
| * | AP012306 | 341,377 | 0 | T | G | 29.1% | 189.9 / 13.1 | 103 | G60G (GGT→GGG) | ribD | fused diaminohydroxyphosphoribosylaminopyrimidin e deaminase and 5‑amino‑6‑(5‑phosphoribosylamino) uracil reductase |
| * | AP012306 | 3,527,368 | 0 | A | C | 28.1% | 593.6 / 54.2 | 255 | L140F (TTA→TTC) | rhaS | DNA‑binding transcriptional activator, L‑rhamnose‑binding |
| * | AP012306 | 1,226,557 | 0 | A | G | 25.9% | 370.9 / 73.4 | 170 | G55G (GGA→GGG) | ydcU | predicted spermidine/putrescine transporter subunit |
| * | AP012306 | 3,903,791 | 0 | A | G | 24.8% | 613.9 / 87.1 | 270 | E189G (GAA→GGA) | yjgJ | predicted transcriptional regulator |
| * | AP012306 | 2,758,909 | 0 | T | G | 24.7% | 606.1 / 18.1 | 228 | G33G (GGT→GGG) | agaD | N‑acetylgalactosamine‑specific enzyme IID component of PTS |
| * | AP012306 | 3,182,861 | 0 | A | C | 24.6% | 339.3 / 13.6 | 130 | L198F (TTA→TTC) | yiaN | predicted transporter |
| * | AP012306 | 800,675 | 0 | A | C | 24.1% | 665.1 / 28.8 | 261 | T192P (ACC→CCC) | lolA | chaperone for lipoproteins |
| * | AP012306 | 257,137 | 0 | T | G | 23.9% | 396.5 / 12.2 | 184 | L496V (TTG→GTG) | betT | choline transporter of high affinity |
| * | AP012306 | 1,854,851 | 0 | A | C | 22.9% | 691.6 / 48.8 | 263 | T25P (ACC→CCC) | yejH | predicted ATP‑dependet helicase |
| * | AP012306 | 406,677 | 0 | A | G | 22.4% | 531.8 / 26.4 | 211 | K294E (AAA→GAA) | hemH | ferrochelatase |
| * | AP012306 | 202,417 | 0 | T | G | 22.2% | 679.8 / 23.2 | 271 | V409G (GTA→GGA) | tilS | tRNA(Ile)‑lysidine synthetase |
| * | AP012306 | 1,128,412 | 0 | T | G | 22.2% | 869.7 / 33.3 | 320 | V29G (GTG→GGG) | yciO | conserved protein |
| * | AP012306 | 3,324,433 | 0 | T | A | 22.1% | 506.7 / 68.2 | 199 | intergenic (+2/+52) | yieF/yieG | chromate reductase, Class I, flavoprotein/predicted inner membrane protein |
| * | AP012306 | 2,558,071 | 0 | A | C | 21.8% | 687.3 / 26.7 | 262 | V302G (GTA→GGA) | visC | predicted oxidoreductase, FAD/NAD(P)‑binding domain |
| Marginal new junction evidence (lowest skew 10 of 31 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | AP012306 | = 215364 | NA (NA) | 8 (0.030) | 8/288 | 12.8 | NA | noncoding (745/2905 nt) | rrlH | 23S ribosomal RNA (rrlH) |
| ? | AP012306 | = 215372 | NA (NA) | noncoding (753/2905 nt) | rrlH | 23S ribosomal RNA (rrlH) | |||||
| * | ? | AP012306 | 2718234 = | 374 (1.200) | 7 (0.020) | 7/274 | 12.9 | 1.9% | intergenic (‑160/‑203) | uxaC/exuT | uronate isomerase/hexuronate transporter |
| ? | AP012306 | 2718246 = | 365 (1.270) | intergenic (‑172/‑191) | uxaC/exuT | uronate isomerase/hexuronate transporter | |||||
| * | ? | AP012306 | = 2275071 | 207 (0.660) | 43 (0.160) +GTATCAGTCTGCTTCGCAAG |
5/258 | 13.5 | 14.6% | noncoding (1/76 nt) | gltW | tRNA‑Glu |
| ? | AP012306 | = 3597478 | 375 (1.200) | intergenic (+65/‑107) | rrsB/gltT | 16S ribosomal RNA (rrnB)/tRNA‑Glu | |||||
| * | ? | AP012306 | = 3429575 | 390 (1.250) | 6 (0.020) | 6/288 | 13.6 | 1.6% | coding (695/765 nt) | yigE | predicted protein |
| ? | AP012306 | = 3429585 | 374 (1.240) | coding (685/765 nt) | yigE | predicted protein | |||||
| * | ? | AP012306 | = 727361 | 269 (0.860) | 5 (0.020) | 5/282 | 14.0 | 2.0% | coding (502/750 nt) | moeB | molybdopterin synthase sulfurylase |
| ? | AP012306 | = 727373 | 246 (0.830) | coding (490/750 nt) | moeB | molybdopterin synthase sulfurylase | |||||
| * | ? | AP012306 | 3353383 = | 269 (0.860) | 5 (0.020) | 5/290 | 14.1 | 1.8% | coding (1464/1890 nt) | gidA | glucose‑inhibited cell‑division protein |
| ? | AP012306 | 3353403 = | 285 (0.940) | coding (1444/1890 nt) | gidA | glucose‑inhibited cell‑division protein | |||||
| * | ? | AP012306 | 2939858 = | 257 (0.820) | 5 (0.020) | 5/290 | 14.1 | 1.9% | coding (1142/2103 nt) | yhfK | conserved inner membrane protein |
| ? | AP012306 | 2939902 = | 268 (0.880) | coding (1186/2103 nt) | yhfK | conserved inner membrane protein | |||||
| * | ? | AP012306 | = 2359634 | 210 (0.670) | 5 (0.020) | 5/288 | 14.1 | 2.4% | coding (143/1827 nt) | hycC | hydrogenase 3, membrane subunit |
| ? | AP012306 | = 2359655 | 205 (0.680) | coding (122/1827 nt) | hycC | hydrogenase 3, membrane subunit | |||||
| * | ? | AP012306 | 3111802 = | 373 (1.190) | 4 (0.010) | 4/274 | 14.3 | 1.1% | coding (554/972 nt) | yhjC | predicted DNA‑binding transcriptional regulator |
| ? | AP012306 | 3111814 = | 345 (1.200) | coding (566/972 nt) | yhjC | predicted DNA‑binding transcriptional regulator | |||||
| * | ? | AP012306 | = 3089215 | 379 (1.210) | 3 (0.010) | 3/248 | 14.4 | 0.92% | intergenic (+235/‑642) | gor/arsR | glutathione oxidoreductase/DNA‑binding transcriptional regulator |
| ? | AP012306 | 3089646 = | 333 (1.280) | intergenic (+666/‑211) | gor/arsR | glutathione oxidoreductase/DNA‑binding transcriptional regulator | |||||