| Predicted mutation | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| MC JC | NC_000913 | 1,394,106 | Δ1,938 bp | IS5‑mediated | [mppA]–ynaI | [mppA], ynaI |
| Missing coverage evidence... | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 1394106 | 1397224–1396040 | 1935–3119 | 68 [3] | [24] 27 | [mppA]–insH1 | [mppA], ynaI, insH1 |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 1394105 | 3 (0.050) | 65 (1.010) | 49/198 | 0.3 | 95.6% | coding (879/1614 nt) | mppA | murein tripeptide (L‑ala‑gamma‑D‑glutamyl‑meso‑DAP) transporter subunit |
| ? | NC_000913 | 1396044 = | NA (NA) | noncoding (1/1195 nt) | IS5 | repeat region | |||||
ATAGTCAGGGAAGGAAGTAGCAACATTAGCTAAGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATAGAACAGGGTTCAT > NC_000913/1396011‑1396110 | aTAGTCAGGGAAGGAAGTAGCAACATTAGCTAAGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATAGAACAGGGTtcat > 1:956517/1‑100 (MQ=255) | ATAGTCAGGGAAGGAAGTAGCAACATTAGCTAAGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATAGAACAGGGTTCAT > NC_000913/1396011‑1396110 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |