mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | NC_000913 | 4,604,344 | 0 | C | T | 43.6% | 62.0 / 57.0 | 78 | S62F (TCT→TTT) | bglJ | DNA‑binding transcriptional regulator BglJ |
| * | NC_000913 | 3,745,397 | 0 | A | C | 33.3% | 120.2 / 18.7 | 73 | L198F (TTA→TTC) | yiaN | 2,3‑diketo‑L‑gulonate:Na(+) symporter ‑ membrane subunit |
| * | NC_000913 | 4,568,504 | 0 | T | G | 33.1% | 236.7 / 31.1 | 130 | T6P (ACC→CCC) | mdtM | multidrug efflux pump/bile salt:H(+) antiporter/Na(+):H(+) antiporter/K(+):H(+) antiporter |
| * | NC_000913 | 770,897 | 0 | T | G | 30.3% | 124.7 / 12.4 | 66 | intergenic (+286/‑561) | mngB/cydA | alpha‑mannosidase/cytochrome bd‑I ubiquinol oxidase subunit I |
| * | NC_000913 | 4,101,507 | 0 | T | G | 30.1% | 174.5 / 17.1 | 83 | intergenic (+77/‑183) | sodA/kdgT | superoxide dismutase (Mn)/2‑dehydro‑3‑deoxy‑D‑gluconate:H(+) symporter |
| * | NC_000913 | 175,694 | 0 | T | G | 28.9% | 161.3 / 17.2 | 77 | G196G (GGT→GGG) | clcA | chloride:H(+) antiporter ClcA |
| * | NC_000913 | 1,825,061 | 0 | G | A | 27.7% | 89.2 / 13.9 | 47 | intergenic (‑124/+79) | ves/spy | HutD family protein Ves/ATP‑independent periplasmic chaperone |
| * | NC_000913 | 3,206,435 | 0 | C | T | 27.6% | 102.7 / 29.8 | 58 | intergenic (‑179/‑28) | ttdR/ttdA | DNA‑binding transcriptional activator Dan/L(+)‑tartrate dehydratase subunit alpha |
| * | NC_000913 | 3,915,866 | 0 | T | G | 26.8% | 186.7 / 12.4 | 83 | Y36S (TAC→TCC) | atpC | ATP synthase F1 complex subunit epsilon |
| * | NC_000913 | 650,809 | 0 | T | G | 26.5% | 154.6 / 16.3 | 68 | T350P (ACC→CCC) | citC | citrate lyase synthetase |
| * | NC_000913 | 2,001,918 | 0 | A | C | 26.0% | 164.2 / 26.1 | 73 | intergenic (‑129/+192) | fliA/fliC | RNA polymerase, sigma 28 (sigma F) factor/flagellar filament structural protein |
| * | NC_000913 | 4,101,514 | 0 | G | T | 24.4% | 215.0 / 22.9 | 78 | intergenic (+84/‑176) | sodA/kdgT | superoxide dismutase (Mn)/2‑dehydro‑3‑deoxy‑D‑gluconate:H(+) symporter |
| * | NC_000913 | 4,296,060 | 0 | C | T | 23.1% | 270.2 / 76.1 | 134 | intergenic (+266/+376) | gltP/yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| * | NC_000913 | 372,640 | 0 | T | G | 22.9% | 161.1 / 17.0 | 70 | L176V (TTA→GTA) | mhpD | 2‑hydroxypentadienoate hydratase |
| * | NC_000913 | 3,401,459 | 0 | T | C | 22.4% | 155.0 / 17.7 | 76 | D625G (GAT→GGT) | csrD | regulator of CsrB and CsrC decay |
| * | NC_000913 | 2,326,450 | 0 | T | G | 22.2% | 240.7 / 42.5 | 99 | G114G (GGT→GGG) | atoB | acetyl‑CoA acetyltransferase |
| * | NC_000913 | 753,125 | 0 | T | A | 21.7% | 222.5 / 28.1 | 92 | intergenic (‑330/+60) | ybgD/gltA | putative fimbrial protein YbgD/citrate synthase |
| * | NC_000913 | 4,111,747 | 0 | G | T | 21.7% | 130.5 / 18.2 | 46 | N156K (AAC→AAA) | yiiQ | DUF1454 domain‑containing protein YiiQ |
| * | NC_000913 | 4,161,148 | 0 | G | A | 20.4% | 270.7 / 20.3 | 108 | E28K (GAA→AAA) | fabR | DNA‑binding transcriptional repressor FabR |
| * | NC_000913 | 29,496 | 0 | T | A | 20.3% | 187.3 / 18.4 | 74 | intergenic (+301/‑155) | dapB/carA | 4‑hydroxy‑tetrahydrodipicolinate reductase/carbamoyl phosphate synthetase subunit alpha |
| Marginal new junction evidence (lowest skew 10 of 27 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 4542690 | 111 (1.010) | 16 (0.160) | 14/260 | 5.3 | 13.4% | intergenic (+57/‑425) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit |
| ? | NC_000913 | = 4542986 | 103 (1.010) | intergenic (+353/‑129) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||
| * | ? | NC_000913 | 4542682 = | 118 (1.080) | 14 (0.140) | 13/260 | 5.5 | 11.6% | intergenic (+49/‑433) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit |
| ? | NC_000913 | 4542996 = | 104 (1.020) | intergenic (+363/‑119) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||
| * | ? | NC_000913 | = 1207805 | 61 (0.560) | 14 (0.140) | 11/246 | 5.9 | 21.1% | coding (305/630 nt) | ycfK | e14 prophage; protein StfP |
| ? | NC_000913 | = 1209602 | 51 (0.530) | pseudogene (54/537 nt) | stfE | e14 prophage; putative side tail fiber protein fragment | |||||
| * | ? | NC_000913 | 340035 = | NA (NA) | 9 (0.080) | 8/276 | 7.6 | NA | coding (243/297 nt) | yahH | putative uncharacterized protein YahH |
| ? | NC_000913 | 377322 = | NA (NA) | intergenic (+11/+213) | yaiL/frmB | DUF2058 domain‑containing protein YaiL/S‑formylglutathione hydrolase FrmB | |||||
| * | ? | NC_000913 | 608007 = | NA (NA) | 9 (0.100) | 4/226 | 8.4 | 8.0% | noncoding (1/1345 nt) | IS186 | repeat region |
| ? | NC_000913 | 609352 = | 104 (1.170) | intergenic (+175/+107) | insL‑2/entD | IS186/IS421 transposase/phosphopantetheinyl transferase EntD | |||||
| * | ? | NC_000913 | 374922 = | NA (NA) | 6 (0.060) | 5/262 | 8.7 | NA | intergenic (+41/‑537) | mhpE/mhpT | 4‑hydroxy‑2‑oxovalerate aldolase/3‑hydroxyphenylpropionate/3‑ hydroxycinnamate:H(+) symporter |
| ? | NC_000913 | 377329 = | NA (NA) | intergenic (+18/+206) | yaiL/frmB | DUF2058 domain‑containing protein YaiL/S‑formylglutathione hydrolase FrmB | |||||
| * | ? | NC_000913 | = 44244 | 102 (0.930) | 10 (0.110) +TCGAAGCAGCTCCAGCCTAC |
4/238 | 8.7 | 18.6% | coding (65/1287 nt) | fixC | putative oxidoreductase FixC |
| ? | NC_000913 | 3104044 = | 0 (0.000) | coding (1032/1053 nt) | mutY | adenine DNA glycosylase | |||||
| * | ? | NC_000913 | 339849 = | NA (NA) | 6 (0.060) | 5/276 | 9.0 | NA | coding (57/297 nt) | yahH | putative uncharacterized protein YahH |
| ? | NC_000913 | 377322 = | NA (NA) | intergenic (+11/+213) | yaiL/frmB | DUF2058 domain‑containing protein YaiL/S‑formylglutathione hydrolase FrmB | |||||
| * | ? | NC_000913 | 339756 = | NA (NA) | 6 (0.060) | 5/276 | 9.0 | NA | intergenic (+13/‑37) | yahG/yahH | DUF1116 domain‑containing protein YahG/putative uncharacterized protein YahH |
| ? | NC_000913 | 377322 = | NA (NA) | intergenic (+11/+213) | yaiL/frmB | DUF2058 domain‑containing protein YaiL/S‑formylglutathione hydrolase FrmB | |||||
| * | ? | NC_000913 | 138770 = | NA (NA) | 3 (0.030) | 3/222 | 9.0 | NA | noncoding (28/34 nt) | other | REP10b |
| ? | NC_000913 | = 4554511 | NA (NA) | noncoding (29/34 nt) | other | REP346 | |||||