breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
Predicted mutations | |||||
---|---|---|---|---|---|
evidence | position | mutation | annotation | gene | description |
MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
RA | 889,923 | A→G | intergenic (‑104/‑166) | ybjL ← / → ybjM | putative transport protein YbjL/putative inner membrane protein |
RA | 1,196,220 | C→T | H366H (CAC→CAT) | icd → | isocitrate dehydrogenase |
RA | 1,196,232 | C→T | T370T (ACC→ACT) | icd → | isocitrate dehydrogenase |
RA | 1,196,245 | T→C | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
RA | 1,196,247 | A→G | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
RA | 1,394,973 | A→G | V317A (GTA→GCA) | ynaI ← | small conductance mechanosensitive channel YnaI |
MC JC | 1,472,706 | Δ78 bp | pseudogene (2188‑2265/3495 nt) | ydbA → | putative outer membrane protein, N‑terminal fragment |
JC | 1,619,119 | (TACTTGCCAGGGCAACTAAT)1→2 | intergenic (‑211/‑1) | marC ← / → marR | inner membrane protein MarC/DNA‑binding transcriptional repressor MarR |
RA | 1,875,207 | T→C | T124A (ACT→GCT) | nimR ← | DNA‑binding transcriptional repressor NimR |
JC JC | 1,879,829 | Δ1 bp :: IS186 (–) +6 bp :: Δ1 bp | coding (115‑120/360 nt) | yeaR ← | DUF1971 domain‑containing protein YeaR |
MC JC | 1,978,503 | Δ776 bp | insB‑5–insA‑5 | insB‑5, insA‑5 | |
RA | 2,173,363 | Δ2 bp | pseudogene (915‑916/1358 nt) | gatC ← | galactitol‑specific PTS enzyme IIC component |
RA | 3,354,487 | C→T | intergenic (‑437/‑238) | yhcC ← / → gltB | radical SAM family oxidoreductase YhcC/glutamate synthase subunit GltB |
RA | 3,560,455 | +G | pseudogene (151/758 nt) | glpR ← | DNA‑binding transcriptional repressor GlpR |
RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
Unassigned missing coverage evidence | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
seq id | start | end | size | ←reads | reads→ | gene | description | |||
* | * | ÷ | NC_000913 | 1196255 | 1211437 | 15183 | 15 [14] | [12] 15 | [icd]–[icdC] | [icd],ymfD,ymfE,lit,intE,xisE,ymfH,ymfI,ymfJ,ymfK,ymfT,ymfL,ymfM,oweE,ymfN,aaaE,ymfR,beeE,jayE,ymfQ,ycfK,tfaP,tfaE,stfE,pinE,mcrA,[icdC] |
* | * | ÷ | NC_000913 | 3423785–3424234 | 3424545–3424238 | 5–761 | 16 [9] | [14] 15 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
Unassigned new junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | = 1299498 | 0 (0.000) | 54 (0.930) | 36/268 | 0.4 | 100% | intergenic (+253/‑33) | ychE/insH21 | putative inner membrane protein/IS5 transposase and trans‑activator |
? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+151/‑484) | insH21/oppA | IS5 transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein | |||||
* | ? | NC_000913 | 3363001 = | 93 (1.560) | 111 (1.870) | 64/274 | 0.0 | 70.2% | coding (195/2382 nt) | yhcD | putative fimbrial usher protein YhcD |
? | NC_000913 | 3766087 = | 2 (0.030) | coding (3905/4134 nt) | rhsA | rhs element protein RhsA | |||||
* | ? | NC_000913 | = 3653230 | NA (NA) | 87 (1.460) | 58/276 | 0.0 | 95.6% | noncoding (1/1195 nt) | IS5 | repeat region |
? | NC_000913 | = 3766089 | 4 (0.070) | coding (3907/4134 nt) | rhsA | rhs element protein RhsA |