breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
Predicted mutations | |||||
---|---|---|---|---|---|
evidence | position | mutation | annotation | gene | description |
MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
JC | 656,962 | (GATGAAAATTTTCATTTAGGTCTGGGATTCACCGCTGGCG)1→2 | coding (406/561 nt) | pagP → | Lipid IVA palmitoyltransferase |
RA | 714,605 | G→C | V350L (GTT→CTT) | pgm → | phosphoglucomutase |
RA | 889,923 | A→G | intergenic (‑104/‑166) | ybjL ← / → ybjM | putative transport protein YbjL/putative inner membrane protein |
RA | 1,746,485 | T→G | noncoding (51/77 nt) | valV → | tRNA‑Val |
JC JC | 1,879,829 | Δ1 bp :: IS186 (–) +6 bp :: Δ1 bp | coding (115‑120/360 nt) | yeaR ← | DUF1971 domain‑containing protein YeaR |
MC JC | 1,978,503 | Δ776 bp | insB‑5–insA‑5 | insB‑5, insA‑5 | |
RA | 2,173,363 | Δ2 bp | pseudogene (915‑916/1358 nt) | gatC ← | galactitol‑specific PTS enzyme IIC component |
MC JC | 2,320,490 | (CAGG)3→2 | coding (448‑451/1827 nt) | atoS → | sensory histidine kinase AtoS |
RA | 2,726,177 | G→T | noncoding (12/120 nt) | rrfG ← | 5S ribosomal RNA |
RA | 3,354,487 | C→T | intergenic (‑437/‑238) | yhcC ← / → gltB | radical SAM family oxidoreductase YhcC/glutamate synthase subunit GltB |
JC JC | 3,433,638 | IS5 (+) +4 bp | intergenic (‑78/‑49) | smf ← / → def | protein Smf/peptide deformylase |
RA | 3,560,455 | +G | pseudogene (151/758 nt) | glpR ← | DNA‑binding transcriptional repressor GlpR |
RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
Unassigned missing coverage evidence | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
seq id | start | end | size | ←reads | reads→ | gene | description | |||
* | * | ÷ | NC_000913 | 729901–730142 | 730412–730307 | 166–512 | 27 [21] | [21] 29 | rhsC | rhs element protein RhsC |
* | * | ÷ | NC_000913 | 2818142 | 2818220 | 79 | 27 [22] | [25] 26 | [argY] | [argY] |
* | * | ÷ | NC_000913 | 3423767–3424234 | 3424536–3424238 | 5–770 | 26 [23] | [25] 27 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
Unassigned new junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | 1207790 = | 34 (0.380) | 78 (0.990) | 47/242 | 0.4 | 76.5% | coding (290/630 nt) | ycfK | e14 prophage; protein StfP |
? | NC_000913 | 1209619 = | 18 (0.230) | pseudogene (37/537 nt) | stfE | e14 prophage; putative side tail fiber protein fragment | |||||
* | ? | NC_000913 | = 1207805 | 34 (0.380) | 82 (1.040) | 51/242 | 0.2 | 77.4% | coding (305/630 nt) | ycfK | e14 prophage; protein StfP |
? | NC_000913 | = 1209602 | 18 (0.230) | pseudogene (54/537 nt) | stfE | e14 prophage; putative side tail fiber protein fragment | |||||
* | ? | NC_000913 | = 1299498 | 0 (0.000) | 32 (0.370) | 24/266 | 2.2 | 100% | intergenic (+253/‑33) | ychE/insH21 | putative inner membrane protein/IS5 transposase and trans‑activator |
? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+151/‑484) | insH21/oppA | IS5 transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein | |||||
* | ? | NC_000913 | 3363001 = | 81 (0.910) | 119 (1.340) | 58/272 | 0.2 | 74.1% | coding (195/2382 nt) | yhcD | putative fimbrial usher protein YhcD |
? | NC_000913 | 3766087 = | 3 (0.030) | coding (3905/4134 nt) | rhsA | rhs element protein RhsA | |||||
* | ? | NC_000913 | = 3653230 | NA (NA) | 73 (0.820) | 56/274 | 0.3 | 98.7% | noncoding (1/1195 nt) | IS5 | repeat region |
? | NC_000913 | = 3766089 | 1 (0.010) | coding (3907/4134 nt) | rhsA | rhs element protein RhsA |