| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913_3_bme_pgi | = 258676 | NA (NA) | 13 (0.580) +CGTGCTATGTATTAATTGCCGAATACGATGTACATATCGGCATCGACC |
7/148 | 1.9 | NA | pseudogene (1/331 nt) | crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers |
| ? | NC_000913_3_bme_pgi | 837584 = | NA (NA) | noncoding (46/123 nt) | REP77 (repetitive extragenic palindromic) element; contains 3 REP sequences | REP77 (repetitive extragenic palindromic) element; contains 3 REP sequences | |||||
No reads uniquely aligned to region.