mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence (highest frequency 20 of 32 shown, sorted by frequency from high to low) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | AP012306 | 1,091,992 | 0 | T | G | 42.9% | 432.4 / 86.4 | 277 | intergenic (+38/‑145) | narI/ychS | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/predicted protein |
| * | AP012306 | 341,377 | 0 | T | G | 35.2% | 196.2 / 13.5 | 122 | G60G (GGT→GGG) | ribD | fused diaminohydroxyphosphoribosylaminopyrimidin e deaminase and 5‑amino‑6‑(5‑phosphoribosylamino) uracil reductase |
| * | AP012306 | 644,417 | 0 | G | A | 33.1% | 803.9 / inf | 587 | intergenic (+32/‑401) | lysQ/nadA | tRNA‑Lys/quinolinate synthase, subunit A |
| * | AP012306 | 3,527,368 | 0 | A | C | 32.0% | 583.6 / 89.6 | 295 | L140F (TTA→TTC) | rhaS | DNA‑binding transcriptional activator, L‑rhamnose‑binding |
| * | AP012306 | 1,944,288 | 0 | A | C | 30.5% | 497.3 / 44.7 | 223 | G361G (GGT→GGG) | menE | o‑succinylbenzoate‑CoA ligase |
| * | AP012306 | 3,938,887 | 0 | C | T | 29.7% | 441.4 / 160.4 | 240 | S44F (TCT→TTT) | bglJ | DNA‑binding transcriptional regulator |
| * | AP012306 | 1,421,147 | 0 | T | G | 28.9% | 413.5 / 17.6 | 199 | T79P (ACC→CCC) | ydhB | predicted DNA‑binding transcriptional regulator |
| * | AP012306 | 2,212,753 | 0 | A | C | 28.8% | 406.9 / 65.6 | 177 | Y241D (TAT→GAT) | hcaT | predicted 3‑phenylpropionic transporter |
| * | AP012306 | 935,054 | 0 | G | T | 27.9% | 280.4 / 66.5 | 111 | intergenic (+24/‑1406) | putP/ycdO | proline:sodium symporter/conserved protein |
| * | AP012306 | 800,675 | 0 | A | C | 27.8% | 699.5 / 46.7 | 303 | T192P (ACC→CCC) | lolA | chaperone for lipoproteins |
| * | AP012306 | 2,758,909 | 0 | T | G | 27.6% | 556.7 / 22.8 | 221 | G33G (GGT→GGG) | agaD | N‑acetylgalactosamine‑specific enzyme IID component of PTS |
| * | AP012306 | 3,639,040 | 0 | T | G | 27.4% | 125.6 / 10.3 | 62 | noncoding (54/76 nt) | gltV | tRNA‑Glu |
| * | AP012306 | 472,868 | 0 | T | G | 27.1% | 531.1 / 32.7 | 214 | D435A (GAC→GCC) | cusS | sensory histidine kinase in two‑component regulatory system with CusR, senses copper ions |
| * | AP012306 | 1,226,557 | 0 | A | G | 26.7% | 394.1 / 74.1 | 180 | G55G (GGA→GGG) | ydcU | predicted spermidine/putrescine transporter subunit |
| * | AP012306 | 1,854,851 | 0 | A | C | 25.1% | 743.7 / 84.9 | 299 | T25P (ACC→CCC) | yejH | predicted ATP‑dependet helicase |
| * | AP012306 | 2,680,345 | 0 | A | C | 24.1% | 467.5 / 26.0 | 197 | T184P (ACC→CCC) | ttdA | L‑tartrate dehydratase, alpha subunit |
| * | AP012306 | 3,182,861 | 0 | A | C | 23.7% | 362.8 / 16.0 | 135 | L198F (TTA→TTC) | yiaN | predicted transporter |
| * | AP012306 | 3,903,791 | 0 | A | G | 23.7% | 538.3 / 61.2 | 228 | E189G (GAA→GGA) | yjgJ | predicted transcriptional regulator |
| * | AP012306 | 2,558,071 | 0 | A | C | 22.9% | 701.2 / 28.2 | 267 | V302G (GTA→GGA) | visC | predicted oxidoreductase, FAD/NAD(P)‑binding domain |
| * | AP012306 | 202,417 | 0 | T | G | 22.6% | 767.9 / 21.1 | 302 | V409G (GTA→GGA) | tilS | tRNA(Ile)‑lysidine synthetase |
| Marginal new junction evidence (lowest skew 10 of 79 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | AP012306 | 644310 = | 378 (1.120) | 30 (0.090) +GAG |
12/292 | 16.8 | 7.6% | noncoding (1/76 nt) | lysQ | tRNA‑Lys |
| ? | AP012306 | = 2073420 | 370 (1.100) | noncoding (76/76 nt) | valU | tRNA‑Val | |||||
| * | ? | AP012306 | = 1092512 | 373 (1.110) | 14 (0.050) | 9/258 | 17.1 | 4.3% | intergenic (+100/+3) | ychS/tpr | predicted protein/predicted protamine‑like protein |
| ? | AP012306 | 1092985 = | 301 (1.040) | noncoding (66/85 nt) | tyrT | tRNA‑Tyr | |||||
| * | ? | AP012306 | 644310 = | 378 (1.120) | 26 (0.080) +G |
9/296 | 18.2 | 6.9% | noncoding (1/76 nt) | lysQ | tRNA‑Lys |
| ? | AP012306 | = 2073542 | 327 (0.970) | intergenic (+2/‑45) | valX/valY | tRNA‑Val/tRNA‑Val | |||||
| * | ? | AP012306 | = 215364 | NA (NA) | 7 (0.020) | 7/288 | 18.9 | NA | noncoding (745/2905 nt) | rrlH | 23S ribosomal RNA (rrlH) |
| ? | AP012306 | = 215372 | NA (NA) | noncoding (753/2905 nt) | rrlH | 23S ribosomal RNA (rrlH) | |||||
| * | ? | AP012306 | 2949719 = | 361 (1.070) | 8 (0.020) | 7/294 | 19.1 | 2.2% | coding (791/807 nt) | nirC | nitrite transporter |
| ? | AP012306 | 2949734 = | 366 (1.100) | coding (806/807 nt) | nirC | nitrite transporter | |||||
| * | ? | AP012306 | 1128871 = | 325 (0.970) | 6 (0.020) | 6/294 | 19.6 | 1.8% | coding (545/621 nt) | yciO | conserved protein |
| ? | AP012306 | 1128895 = | 335 (1.010) | coding (569/621 nt) | yciO | conserved protein | |||||
| * | ? | AP012306 | 805307 = | 373 (1.110) | 6 (0.020) | 6/292 | 19.6 | 1.6% | coding (1616/2445 nt) | dmsA | dimethyl sulfoxide reductase, anaerobic, subunit A |
| ? | AP012306 | 805325 = | 364 (1.110) | coding (1634/2445 nt) | dmsA | dimethyl sulfoxide reductase, anaerobic, subunit A | |||||
| * | ? | AP012306 | 727021 = | 353 (1.050) | 5 (0.020) | 5/278 | 19.8 | 1.5% | coding (647/663 nt) | fsaA | fructose‑6‑phosphate aldolase 1 |
| ? | AP012306 | 727051 = | 344 (1.100) | intergenic (+14/+62) | fsaA/moeB | fructose‑6‑phosphate aldolase 1/molybdopterin synthase sulfurylase | |||||
| * | ? | AP012306 | = 2833517 | 278 (0.830) | 5 (0.020) | 5/284 | 19.9 | 1.8% | coding (987/1419 nt) | gltD | glutamate synthase, 4Fe‑4S protein, small subunit |
| ? | AP012306 | = 2833534 | 267 (0.830) | coding (1004/1419 nt) | gltD | glutamate synthase, 4Fe‑4S protein, small subunit | |||||
| * | ? | AP012306 | = 2275071 | 239 (0.710) | 33 (0.110) +GTATCAGTCTGCTTCGCAAG |
4/258 | 19.9 | 11.4% | noncoding (1/76 nt) | gltW | tRNA‑Glu |
| ? | AP012306 | = 3597478 | 356 (1.060) | intergenic (+65/‑107) | rrsB/gltT | 16S ribosomal RNA (rrnB)/tRNA‑Glu | |||||