![]() |
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
| MC | 279,931 | Δ11,471 bp | between IS1 | yagB–insA‑3 | yagB, yagA, yagE, yagF, yagG, yagH, xynR, argF, ykgS, insB‑3, insA‑3 |
| RA | 889,923 | A→G | intergenic (‑104/‑166) | ybjL ← / → ybjM | putative transport protein YbjL/putative inner membrane protein |
| RA | 1,212,088 | (C)8→9 | intergenic (‑85/+172) | iraM ← / ← ymgK | anti‑adaptor protein IraM, inhibitor of sigma(S) proteolysis/protein YmgK |
| RA | 1,393,269 | Δ1 bp | coding (43/1614 nt) | mppA → | murein tripeptide ABC transporter periplasmic binding protein |
| JC JC | 1,879,829 | Δ1 bp :: IS186 (–) +6 bp :: Δ1 bp | coding (115‑120/360 nt) | yeaR ← | DUF1971 domain‑containing protein YeaR |
| MC JC | 1,978,503 | Δ776 bp | insB‑5–insA‑5 | insB‑5, insA‑5 | |
| RA | 2,170,111 | G→C | pseudogene (57/475 nt) | gatR ← | DNA‑binding transcriptional repressor GatR, N‑terminal fragment |
| RA | 2,173,363 | Δ2 bp | pseudogene (915‑916/1358 nt) | gatC ← | galactitol‑specific PTS enzyme IIC component |
| RA | 2,947,343 | (A)8→7 | intergenic (‑165/‑44) | mltA ← / → metZ | membrane‑bound lytic murein transglycosylase A/tRNA‑Met |
| JC | 3,155,840 | (CGGTGATCTCCCGTAAAACCACAGGCGACAAGCAGGCG)1→2 | coding (486/1164 nt) | yqhD → | NADPH‑dependent aldehyde reductase YqhD |
| RA | 3,354,487 | C→T | intergenic (‑437/‑238) | yhcC ← / → gltB | radical SAM family oxidoreductase YhcC/glutamate synthase subunit GltB |
| RA | 3,560,455 | +G | pseudogene (151/758 nt) | glpR ← | DNA‑binding transcriptional repressor GlpR |
| RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
| RA | 3,921,953 | (G)6→5 | coding (99/816 nt) | atpB ← | ATP synthase Fo complex subunit a |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 3423766–3424233 | 3424540–3424238 | 6–775 | 20 [17] | [16] 19 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 52 (0.760) | 38/268 | 0.6 | 100% | intergenic (+253/‑33) | ychE/insH21 | putative inner membrane protein/IS5 transposase and trans‑activator |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+151/‑484) | insH21/oppA | IS5 transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | 3363001 = | 92 (1.300) | 109 (1.550) | 58/274 | 0.1 | 70.0% | coding (195/2382 nt) | yhcD | putative fimbrial usher protein YhcD |
| ? | NC_000913 | 3766087 = | 2 (0.030) | coding (3905/4134 nt) | rhsA | rhs element protein RhsA | |||||
| * | ? | NC_000913 | = 3653230 | NA (NA) | 78 (1.100) | 48/276 | 0.3 | 96.3% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 3766089 | 3 (0.040) | coding (3907/4134 nt) | rhsA | rhs element protein RhsA | |||||