mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.29.0 revision 8f9c342918e4
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| MC JC | 257,908 | Δ776 bp | [crl] | [crl] | |
| MC JC | 1,299,499 | Δ1,199 bp | intergenic (+254/‑485) | ychE → / → oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein |
| MC JC | 1,978,503 | Δ776 bp | insB1–insA | insB1, insA | |
| RA | 2,173,363 | Δ2 bp | intergenic (‑1/+1) | gatC ← / ← gatC | pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC |
| RA | 2,725,672 | (C)5→4 | coding (75/1299 nt) | kgtP ← | alpha‑ketoglutarate transporter |
| RA | 2,805,532 | +T | coding (718/1203 nt) | proV → | glycine betaine/proline ABC transporter periplasmic binding protein |
| JC JC | 3,328,463 | IS4 (–) +11 bp | coding (243‑253/477 nt) | greA ← | transcript cleavage factor |
| JC | 3,377,241 | (AGCTCACGATCCACCAGGGTC)1→2 | coding (180/639 nt) | sspA ← | stringent starvation protein A, phage P1 late gene activator, RNAP‑associated acid‑resistance protein, inactive glutathione S‑transferase homolog |
| RA | 3,522,182 | C→A | T190T (ACG→ACT) | hofM ← | DNA catabolic putative pilus assembly protein |
| RA | 3,560,455 | +G | intergenic (‑2/+1) | glpR ← / ← glpR | pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon |
| JC JC | 3,751,884 | IS5 (+) +4 bp | intergenic (‑16/‑105) | yiaT ← / → yiaU | putative outer membrane protein/putative DNA‑binding transcriptional regulator |
| RA | 3,823,664 | T→C | V422A (GTG→GCG) | spoT → | bifunctional (p)ppGpp synthetase II/ guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 2726172–2729245 | 2730860–2729571 | 327–4689 | 21 [19] | [19] 21 | [rrfG]–[rrsG] | [rrfG], rrlG, gltW, [rrsG] |
| * | * | ÷ | NC_000913 | 3423737–3424234 | 3424565–3424238 | 5–829 | 21 [20] | [20] 21 | [rrfD]–[rrlD] | [rrfD], [rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 1207790 = | 16 (0.350) | 15 (0.370) | 15/266 | 2.9 | 49.8% | coding (290/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913 | 1209619 = | 16 (0.390) | pseudogene (1/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||
| * | ? | NC_000913 | = 1207805 | 16 (0.350) | 18 (0.440) | 17/266 | 2.4 | 54.3% | coding (305/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913 | = 1209602 | 16 (0.390) | pseudogene (18/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||