Sample Resequencing Stats

Note: The mutation counts shown below represent unfiltered mutation sets.
ALE, Flask, Isolate Predicted Mutations Mean Coverage Total Reads Percent Mapped Mapped Reads Average Read Length
A2 F3 I0 R1 328 90.1 2317887 85.2% 1974839 62.5

Breseq alignment

BRESEQ :: Evidence
Predicted mutation
evidence seq id position mutation freq annotation gene description
RA minE 1,600,586 Δ5 bp 100% coding (856‑860/1425 nt) murP → fused predicted enzyme IIBC components of PTS

Read alignment evidence...
  seq id position ref new freq score (cons/poly) reads annotation genes product
*minE1,600,5860A.100.0% 29.7 / NA 8coding (856/1425 nt)murPfused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base A (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,600,5870T.100.0% 29.7 / NA 8coding (857/1425 nt)murPfused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base T (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,600,5880G.100.0% 29.7 / NA 8coding (858/1425 nt)murPfused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base G (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,600,5890T.100.0% 29.7 / NA 8coding (859/1425 nt)murPfused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base T (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,600,5900C.100.0% 29.7 / NA 8coding (860/1425 nt)murPfused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base C (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.

GCCGCTGGGTGGCTGGTTATTCGAAGGTATGTCATGGCTGTTTATGCACCTGAACAGTAATC  >  minE/1600558‑1600619
                            |||||                             
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTaa    >  1:32821/1‑55 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:1044091/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:1069841/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:171714/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:2095591/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:2194277/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:316430/1‑57 (MQ=255)
gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:758857/1‑57 (MQ=255)
                            |||||                             
GCCGCTGGGTGGCTGGTTATTCGAAGGTATGTCATGGCTGTTTATGCACCTGAACAGTAATC  >  minE/1600558‑1600619

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 21 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 

GATK/CNVnator alignment

N/A