Sample Resequencing Stats

Note: The mutation counts shown below represent unfiltered mutation sets.
ALE, Flask, Isolate Predicted Mutations Mean Coverage Total Reads Percent Mapped Mapped Reads Average Read Length
A2 F21 I0 R2 44 10.9 588504 78.3% 460798 57.0

Breseq alignment

BRESEQ :: Evidence
Predicted mutation
evidence seq id position mutation freq annotation gene description
RA minE 1,668,114 G→A 100% L399L (CTG→CTA xseA → exonuclease VII, large subunit

Read alignment evidence...
  seq id position ref new freq score (cons/poly) reads annotation genes product
*minE1,668,1140GA87.5% 16.6 / ‑2.9 8L399L (CTG→CTAxseAexonuclease VII, large subunit
Reads supporting (aligned to +/- strand):  ref base G (0/1);  new base A (3/4);  total (3/5)
Fisher's exact test for biased strand distribution p-value = 1.00e+00
Kolmogorov-Smirnov test that lower quality scores support variant p-value = 1.00e+00
Rejected as polymorphism: E-value score below prediction cutoff.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.

TTTCGGTAATGCAGTAACGCACCTCGAAGCCGTAAGCCCACTGTCAACGCTGGCGCGTGGAT  >  minE/1668072‑1668133
                                          |                   
tttCGGTAATGCAGTAACGCACCTCGAAGCCGTAAGCCCACTGTCAACGCTGGCGCGTGGAt  <  1:371849/62‑1 (MQ=255)
tttCGGTAATGCAGTAACGCACCTCGAAGCCGTAAGCCCACTATCAACGCTGGCGCGTGGAt  <  1:212336/62‑1 (MQ=255)
tttCGGTAATGCAGTAACGCACCTCGAAGCCGTAAGCCCACTATCAACGCTGGCGCGTGGAt  <  1:371267/62‑1 (MQ=255)
tttCGGTAATGCAGTAACGCACCTCAAAGCCGTAAGCCCACTATCAACGCTGGCGCGTGGAt  <  1:550226/62‑1 (MQ=255)
 ttCGGTAATGCAGTAACGCACCTCGAAGCCGTAAGCCCACTATCAACGCTGGCGCGTGGa   >  1:215913/1‑60 (MQ=255)
 ttCGGTAATGCAGTAACGCACCTCGAAGCCGTAAGCCCACTATCAACGCTGGCGCGTGGa   >  1:321453/1‑60 (MQ=255)
 ttCGGTAATGCAGTAACGCACCTCGAAGCCGTAAGCCCACTATCAACGCTGGCGCGTGGa   >  1:339810/1‑60 (MQ=255)
 ttCGGTAATGCAGTAACGCACCTCGAAGCCGTAAGCCCACTATCAACGCTGGCGCGTGGAt  <  1:241192/61‑1 (MQ=255)
                                          |                   
TTTCGGTAATGCAGTAACGCACCTCGAAGCCGTAAGCCCACTGTCAACGCTGGCGCGTGGAT  >  minE/1668072‑1668133

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 

GATK/CNVnator alignment

N/A