Sample Resequencing Stats

Note: The mutation counts shown below represent unfiltered mutation sets.
ALE, Flask, Isolate Predicted Mutations Mean Coverage Total Reads Percent Mapped Mapped Reads Average Read Length
A2 F21 I0 R2 44 10.9 588504 78.3% 460798 57.0

Breseq alignment

BRESEQ :: Evidence
Predicted mutation
evidence seq id position mutation freq annotation gene description
RA minE 1,669,352:1 +AAC 100% coding (691/1473 nt) der ← predicted GTP‑binding protein

Read alignment evidence...
  seq id position ref new freq score (cons/poly) reads annotation genes product
*minE1,669,3521.A100.0% 17.5 / NA 7Y231? (TAC→NAC) derpredicted GTP‑binding protein
Reads supporting (aligned to +/- strand):  ref base . (0/0);  new base A (0/7);  total (0/7)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,669,3522.A100.0% 17.5 / NA 7Y231? (TAC→NAC) derpredicted GTP‑binding protein
Reads supporting (aligned to +/- strand):  ref base . (0/0);  new base A (0/7);  total (0/7)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*minE1,669,3523.C100.0% 19.6 / NA 7Y231D (TAC→GAC) derpredicted GTP‑binding protein
Reads supporting (aligned to +/- strand):  ref base . (0/0);  new base C (0/7);  total (0/7)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.

TGTCACGCGTCGTGCCAGGCATGTCGTA‑‑‑AACAACAACGCGCTCTTCACCAAGAATACG  >  minE/1669325‑1669382
                            |||                              
tGTCACGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:150417/61‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:101962/57‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:44479/57‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:515247/57‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:555968/57‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCGTAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:574444/57‑1 (MQ=255)
    aCGCGTCGTGCCAGGCATGTCATAAACAACAACAACGCGCTCTTCACCAAGAATACg  <  1:28112/57‑1 (MQ=255)
                            |||                              
TGTCACGCGTCGTGCCAGGCATGTCGTA‑‑‑AACAACAACGCGCTCTTCACCAAGAATACG  >  minE/1669325‑1669382

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 

GATK/CNVnator alignment

N/A