Sample Resequencing Stats

Note: The mutation counts shown below represent unfiltered mutation sets.
ALE, Flask, Isolate Predicted Mutations Mean Coverage Total Reads Percent Mapped Mapped Reads Average Read Length
A2 F8 I0 R1 82 77.9 2158605 86.8% 1873669 62.5

Breseq alignment

BRESEQ :: Evidence
Predicted mutation
evidence seq id position mutation freq annotation gene description
RA minE 1,520,182 Δ1 bp 100% coding (707/813 nt) truA ← pseudouridylate synthase I

Read alignment evidence...
  seq id position ref new freq score (cons/poly) reads annotation genes product
*minE1,520,1820G.100.0% 11.7 / NA 4coding (707/813 nt)truApseudouridylate synthase I
Reads supporting (aligned to +/- strand):  ref base G (0/0);  new base . (0/4);  total (0/4)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.

CCCTTCCGCTTTTGCCGTTGCTGCCGCCAGCGTTCTGTCCTTTGCCGCCAGCAACTCTGCTATCCAGC  >  minE/1520157‑1520224
                         |                                          
cccTTCCGCTTTTGCCGTTGCTGCCCCAGCTTTCTGTCCTTTGCCGCCAGCAACTCTGCTATCCAGc  <  1:1883359/67‑1 (MQ=255)
cccTTCCGCTTTTGCCGTTGCTGCCCCAGCGTTCTGTCCTTTGCCGCCAGCAACTCTGCTATCCAGc  <  1:1110294/67‑1 (MQ=255)
cccTTCCGCTTTTGCCGTTGCTGCCCCAGCGTTCTGTCCTTTGCCGCCAGCAACTCTGCTATCCAGc  <  1:756035/67‑1 (MQ=255)
 ccTTCCGCTTTTGCCGTTGCTGCCCCAGCGTTCTGTCCTTTGCCGCCAGCAACTCTGCTATCCAGc  <  1:367982/66‑1 (MQ=255)
                         |                                          
CCCTTCCGCTTTTGCCGTTGCTGCCGCCAGCGTTCTGTCCTTTGCCGCCAGCAACTCTGCTATCCAGC  >  minE/1520157‑1520224

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 21 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 

GATK/CNVnator alignment

N/A