![]() |
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence (highest frequency 20 of 28 shown, sorted by frequency from high to low) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | AP012306 | 1,091,992 | 0 | T | G | 40.6% | 433.9 / 66.2 | 251 | intergenic (+38/‑145) | narI/ychS | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/predicted protein |
| * | AP012306 | 341,377 | 0 | T | G | 32.6% | 201.8 / 28.2 | 129 | G60G (GGT→GGG) | ribD | fused diaminohydroxyphosphoribosylaminopyrimidin e deaminase and 5‑amino‑6‑(5‑phosphoribosylamino) uracil reductase |
| * | AP012306 | 1,944,288 | 0 | A | C | 31.8% | 531.0 / 55.7 | 245 | G361G (GGT→GGG) | menE | o‑succinylbenzoate‑CoA ligase |
| * | AP012306 | 644,417 | 0 | G | A | 30.5% | 704.4 / inf | 459 | intergenic (+32/‑401) | lysQ/nadA | tRNA‑Lys/quinolinate synthase, subunit A |
| * | AP012306 | 1,421,147 | 0 | T | G | 28.9% | 396.6 / 10.2 | 197 | T79P (ACC→CCC) | ydhB | predicted DNA‑binding transcriptional regulator |
| * | AP012306 | 3,527,368 | 0 | A | C | 28.7% | 1034.5 / 97.6 | 428 | L140F (TTA→TTC) | rhaS | DNA‑binding transcriptional activator, L‑rhamnose‑binding |
| * | AP012306 | 3,938,887 | 0 | C | T | 27.6% | 445.1 / 124.6 | 221 | S44F (TCT→TTT) | bglJ | DNA‑binding transcriptional regulator |
| * | AP012306 | 1,309,914 | 0 | A | C | 27.6% | 227.8 / 10.1 | 116 | L23F (TTA→TTC) | lsrC | AI2 transporter |
| * | AP012306 | 800,675 | 0 | A | C | 26.2% | 582.1 / 34.1 | 240 | T192P (ACC→CCC) | lolA | chaperone for lipoproteins |
| * | AP012306 | 1,854,851 | 0 | A | C | 25.6% | 702.1 / 58.8 | 274 | T25P (ACC→CCC) | yejH | predicted ATP‑dependet helicase |
| * | AP012306 | 1,226,557 | 0 | A | G | 25.0% | 428.5 / 70.1 | 188 | G55G (GGA→GGG) | ydcU | predicted spermidine/putrescine transporter subunit |
| * | AP012306 | 3,412,049 | 0 | T | G | 23.6% | 1641.8 / 68.9 | 646 | intergenic (+25/‑122) | proM/aslB | tRNA‑Pro/predicted regulator of arylsulfatase activity |
| * | AP012306 | 3,324,433 | 0 | T | A | 23.4% | 603.0 / 87.2 | 248 | intergenic (+2/+52) | yieF/yieG | chromate reductase, Class I, flavoprotein/predicted inner membrane protein |
| * | AP012306 | 3,182,861 | 0 | A | C | 23.3% | 370.5 / 12.3 | 134 | L198F (TTA→TTC) | yiaN | predicted transporter |
| * | AP012306 | 3,590,367 | 0 | A | C | 23.3% | 1346.3 / 59.1 | 486 | T30P (ACC→CCC) | fabR | DNA‑binding transcriptional repressor |
| * | AP012306 | 935,054 | 0 | G | T | 23.2% | 245.3 / 38.3 | 82 | intergenic (+24/‑1406) | putP/ycdO | proline:sodium symporter/conserved protein |
| * | AP012306 | 2,857,911 | 0 | A | C | 22.8% | 577.4 / 15.4 | 202 | K180N (AAA→AAC) | aaeR | predicted DNA‑binding transcriptional regulator, efflux system |
| * | AP012306 | 1,128,412 | 0 | T | G | 22.6% | 712.2 / 28.0 | 265 | V29G (GTG→GGG) | yciO | conserved protein |
| * | AP012306 | 3,903,791 | 0 | A | G | 21.8% | 562.0 / 56.8 | 226 | E189G (GAA→GGA) | yjgJ | predicted transcriptional regulator |
| * | AP012306 | 2,714,555 | 0 | T | G | 21.6% | 709.1 / 17.3 | 270 | T175P (ACC→CCC) | ygjV | conserved inner membrane protein |
| Marginal new junction evidence (lowest skew 10 of 102 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | AP012306 | = 1092512 | 359 (1.120) | 20 (0.070) | 13/258 | 15.4 | 6.7% | intergenic (+100/+3) | ychS/tpr | predicted protein/predicted protamine‑like protein |
| ? | AP012306 | 1092985 = | 244 (0.880) | noncoding (66/85 nt) | tyrT | tRNA‑Tyr | |||||
| * | ? | AP012306 | = 997497 | 277 (0.860) | 14 (0.050) | 14/268 | 15.4 | 5.2% | coding (41/1305 nt) | ndh | respiratory NADH dehydrogenase 2/cupric reductase |
| ? | AP012306 | 997993 = | 263 (0.910) | coding (537/1305 nt) | ndh | respiratory NADH dehydrogenase 2/cupric reductase | |||||
| * | ? | AP012306 | = 215364 | NA (NA) | 12 (0.040) | 12/288 | 16.7 | NA | noncoding (745/2905 nt) | rrlH | 23S ribosomal RNA (rrlH) |
| ? | AP012306 | = 215372 | NA (NA) | noncoding (753/2905 nt) | rrlH | 23S ribosomal RNA (rrlH) | |||||
| * | ? | AP012306 | = 1092334 | 294 (0.910) | 10 (0.040) | 8/258 | 17.6 | 3.9% | coding (198/276 nt) | ychS | predicted protein |
| ? | AP012306 | 1092985 = | 244 (0.880) | noncoding (66/85 nt) | tyrT | tRNA‑Tyr | |||||
| * | ? | AP012306 | = 3528620 | 602 (1.870) | 7 (0.020) | 7/294 | 19.1 | 1.2% | coding (852/939 nt) | rhaR | DNA‑binding transcriptional activator, L‑rhamnose‑binding |
| ? | AP012306 | = 3528633 | 587 (1.850) | coding (865/939 nt) | rhaR | DNA‑binding transcriptional activator, L‑rhamnose‑binding | |||||
| * | ? | AP012306 | = 1341258 | 291 (0.900) | 6 (0.020) | 6/294 | 19.6 | 2.1% | coding (1607/2427 nt) | ynfE | oxidoreductase subunit |
| ? | AP012306 | = 1341274 | 280 (0.880) | coding (1623/2427 nt) | ynfE | oxidoreductase subunit | |||||
| * | ? | AP012306 | = 1211471 | 305 (0.950) | 6 (0.020) | 6/292 | 19.6 | 1.9% | intergenic (+34/‑29) | ydcH/rimL | predicted protein/ribosomal‑protein‑L7/L12‑serine acetyltransferase |
| ? | AP012306 | = 1211495 | 316 (1.000) | intergenic (+58/‑5) | ydcH/rimL | predicted protein/ribosomal‑protein‑L7/L12‑serine acetyltransferase | |||||
| * | ? | AP012306 | 3606863 = | 365 (1.130) | 5 (0.020) | 5/284 | 19.9 | 1.4% | coding (293/384 nt) | secE | preprotein translocase membrane subunit |
| ? | AP012306 | 3606878 = | 341 (1.110) | coding (308/384 nt) | secE | preprotein translocase membrane subunit | |||||
| * | ? | AP012306 | = 2308127 | 364 (1.130) | 5 (0.020) | 5/284 | 19.9 | 1.4% | coding (73/525 nt) | ygaP | predicted inner membrane protein with hydrolase activity |
| ? | AP012306 | = 2308138 | 357 (1.160) | coding (84/525 nt) | ygaP | predicted inner membrane protein with hydrolase activity | |||||
| * | ? | AP012306 | = 2275071 | 207 (0.640) | 48 (0.170) +GTATCAGTCTGCTTCGCAAG |
4/258 | 19.9 | 17.4% | noncoding (1/76 nt) | gltW | tRNA‑Glu |
| ? | AP012306 | = 3597478 | 321 (1.000) | intergenic (+65/‑107) | rrsB/gltT | 16S ribosomal RNA (rrnB)/tRNA‑Glu | |||||