mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence (highest frequency 20 of 32 shown, sorted by frequency from high to low) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | AP012306 | 1,091,992 | 0 | T | G | 38.8% | 549.5 / 97.0 | 318 | intergenic (+38/‑145) | narI/ychS | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/predicted protein |
| * | AP012306 | 3,938,887 | 0 | C | T | 33.9% | 405.4 / 187.5 | 248 | S44F (TCT→TTT) | bglJ | DNA‑binding transcriptional regulator |
| * | AP012306 | 644,417 | 0 | G | A | 33.6% | 820.6 / inf | 608 | intergenic (+32/‑401) | lysQ/nadA | tRNA‑Lys/quinolinate synthase, subunit A |
| * | AP012306 | 1,944,288 | 0 | A | C | 32.8% | 530.9 / 66.4 | 262 | G361G (GGT→GGG) | menE | o‑succinylbenzoate‑CoA ligase |
| * | AP012306 | 1,066,323 | 0 | A | C | 31.8% | 547.9 / 42.6 | 243 | intergenic (‑92/+33) | ychM/prsA | predicted transporter/phosphoribosylpyrophosphate synthase |
| * | AP012306 | 341,377 | 0 | T | G | 30.6% | 252.7 / 21.9 | 147 | G60G (GGT→GGG) | ribD | fused diaminohydroxyphosphoribosylaminopyrimidin e deaminase and 5‑amino‑6‑(5‑phosphoribosylamino) uracil reductase |
| * | AP012306 | 1,421,147 | 0 | T | G | 29.5% | 489.3 / 14.8 | 238 | T79P (ACC→CCC) | ydhB | predicted DNA‑binding transcriptional regulator |
| * | AP012306 | 3,527,368 | 0 | A | C | 28.8% | 769.1 / 71.4 | 327 | L140F (TTA→TTC) | rhaS | DNA‑binding transcriptional activator, L‑rhamnose‑binding |
| * | AP012306 | 2,758,909 | 0 | T | G | 28.8% | 654.2 / 34.7 | 271 | G33G (GGT→GGG) | agaD | N‑acetylgalactosamine‑specific enzyme IID component of PTS |
| * | AP012306 | 257,137 | 0 | T | G | 28.6% | 410.3 / 13.6 | 204 | L496V (TTG→GTG) | betT | choline transporter of high affinity |
| * | AP012306 | 2,212,753 | 0 | A | C | 28.2% | 431.3 / 59.2 | 188 | Y241D (TAT→GAT) | hcaT | predicted 3‑phenylpropionic transporter |
| * | AP012306 | 800,675 | 0 | A | C | 27.2% | 668.5 / 38.4 | 291 | T192P (ACC→CCC) | lolA | chaperone for lipoproteins |
| * | AP012306 | 406,677 | 0 | A | G | 27.0% | 462.0 / 28.9 | 200 | K294E (AAA→GAA) | hemH | ferrochelatase |
| * | AP012306 | 1,854,851 | 0 | A | C | 26.3% | 646.5 / 78.0 | 274 | T25P (ACC→CCC) | yejH | predicted ATP‑dependet helicase |
| * | AP012306 | 1,226,557 | 0 | A | G | 25.9% | 459.8 / 98.4 | 212 | G55G (GGA→GGG) | ydcU | predicted spermidine/putrescine transporter subunit |
| * | AP012306 | 2,558,071 | 0 | A | C | 24.5% | 710.2 / 36.6 | 282 | V302G (GTA→GGA) | visC | predicted oxidoreductase, FAD/NAD(P)‑binding domain |
| * | AP012306 | 3,903,791 | 0 | A | G | 23.9% | 641.4 / 73.3 | 272 | E189G (GAA→GGA) | yjgJ | predicted transcriptional regulator |
| * | AP012306 | 3,590,367 | 0 | A | C | 23.5% | 891.5 / 37.0 | 328 | T30P (ACC→CCC) | fabR | DNA‑binding transcriptional repressor |
| * | AP012306 | 202,417 | 0 | T | G | 23.2% | 829.6 / 26.5 | 326 | V409G (GTA→GGA) | tilS | tRNA(Ile)‑lysidine synthetase |
| * | AP012306 | 3,372,701 | 0 | T | G | 23.2% | 186.5 / 13.4 | 82 | noncoding (54/76 nt) | gltU | tRNA‑Glu |
| Marginal new junction evidence (lowest skew 10 of 53 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | AP012306 | = 997497 | 368 (1.020) | 11 (0.030) | 11/268 | 15.6 | 3.2% | coding (41/1305 nt) | ndh | respiratory NADH dehydrogenase 2/cupric reductase |
| ? | AP012306 | 997993 = | 341 (1.050) | coding (537/1305 nt) | ndh | respiratory NADH dehydrogenase 2/cupric reductase | |||||
| * | ? | AP012306 | = 1092334 | 323 (0.890) | 14 (0.040) | 10/258 | 15.7 | 4.5% | coding (198/276 nt) | ychS | predicted protein |
| ? | AP012306 | 1092985 = | 319 (1.020) | noncoding (66/85 nt) | tyrT | tRNA‑Tyr | |||||
| * | ? | AP012306 | = 1092512 | 442 (1.220) | 16 (0.050) | 9/258 | 16.2 | 4.4% | intergenic (+100/+3) | ychS/tpr | predicted protein/predicted protamine‑like protein |
| ? | AP012306 | 1092985 = | 319 (1.020) | noncoding (66/85 nt) | tyrT | tRNA‑Tyr | |||||
| * | ? | AP012306 | = 2094536 | 310 (0.860) | 8 (0.020) | 8/274 | 17.0 | 2.7% | coding (394/834 nt) | cysU | sulfate/thiosulfate transporter subunit |
| ? | AP012306 | = 2094524 | 285 (0.860) | coding (406/834 nt) | cysU | sulfate/thiosulfate transporter subunit | |||||
| * | ? | AP012306 | 3604993 = | 409 (1.130) | 6 (0.020) | 6/284 | 18.2 | 1.5% | noncoding (27/76 nt) | thrT | tRNA‑Thr |
| ? | AP012306 | 3605010 = | 389 (1.130) | noncoding (44/76 nt) | thrT | tRNA‑Thr | |||||
| * | ? | AP012306 | 2650038 = | 525 (1.450) | 6 (0.020) | 6/292 | 18.4 | 1.2% | intergenic (‑113/‑39) | ygiW/qseB | conserved protein/DNA‑binding response regulator in two‑component regulatory system with QseC |
| ? | AP012306 | 2650053 = | 503 (1.420) | intergenic (‑128/‑24) | ygiW/qseB | conserved protein/DNA‑binding response regulator in two‑component regulatory system with QseC | |||||
| * | ? | AP012306 | = 2125209 | 362 (1.000) | 5 (0.020) | 5/274 | 18.5 | 1.5% | coding (917/951 nt) | talA | transaldolase A |
| ? | AP012306 | = 2125197 | 338 (1.020) | coding (905/951 nt) | talA | transaldolase A | |||||
| * | ? | AP012306 | = 2275071 | 218 (0.600) | 51 (0.160) +GTATCAGTCTGCTTCGCAAG |
4/258 | 18.8 | 15.6% | noncoding (1/76 nt) | gltW | tRNA‑Glu |
| ? | AP012306 | = 3597478 | 420 (1.160) | intergenic (+65/‑107) | rrsB/gltT | 16S ribosomal RNA (rrnB)/tRNA‑Glu | |||||
| * | ? | AP012306 | 955967 = | 328 (0.910) | 5 (0.010) | 5/292 | 18.9 | 1.5% | intergenic (+2096/‑575) | mdoG/yceK | glucan biosynthesis protein, periplasmic/predicted lipoprotein |
| ? | AP012306 | 955990 = | 332 (0.940) | intergenic (+2119/‑552) | mdoG/yceK | glucan biosynthesis protein, periplasmic/predicted lipoprotein | |||||
| * | ? | AP012306 | 854835 = | 293 (0.810) | 5 (0.010) | 5/290 | 18.9 | 1.7% | coding (1481/2613 nt) | pepN | aminopeptidase N |
| ? | AP012306 | 854853 = | 286 (0.810) | coding (1499/2613 nt) | pepN | aminopeptidase N | |||||