mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.29.0 revision 8f9c342918e4
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | NC_000913 | 2,767,438 | 1 | . | C | 74.4% | 229.0 / 80.9 | 88 | intergenic (+83/‑272) | rnlB/yfjP | CP4‑57 prophage; uncharacterized protein/CP4‑57 prophage; 50S ribosome‑binding GTPase family protein |
| * | NC_000913 | 3,781,152 | 0 | A | G | 23.8% | 188.9 / 25.7 | 101 | intergenic (+135/‑63) | lldD/trmL | L‑lactate dehydrogenase, FMN‑linked/tRNA Leu mC34,mU34 2'‑O‑methyltransferase, SAM‑dependent |
| Marginal new junction evidence (lowest skew 10 of 185 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 1198454 = | 152 (1.340) | 6 (0.100) +44 bp |
5/110 | 9.8 | 6.6% | intergenic (‑217/‑241) | ymfE/lit | e14 prophage; putative inner membrane protein/T4 phage exclusion protein; cell death peptidase, e14 prophage |
| ? | NC_000913 | = 1198505 | 158 (1.390) | intergenic (‑268/‑190) | ymfE/lit | e14 prophage; putative inner membrane protein/T4 phage exclusion protein; cell death peptidase, e14 prophage | |||||
| * | ? | NC_000913 | 1198454 = | 152 (1.340) | 6 (0.080) +36 bp |
4/126 | 11.8 | 5.8% | intergenic (‑217/‑241) | ymfE/lit | e14 prophage; putative inner membrane protein/T4 phage exclusion protein; cell death peptidase, e14 prophage |
| ? | NC_000913 | = 1198505 | 158 (1.390) | intergenic (‑268/‑190) | ymfE/lit | e14 prophage; putative inner membrane protein/T4 phage exclusion protein; cell death peptidase, e14 prophage | |||||
| * | ? | NC_000913 | = 2305015 | 124 (1.090) | 4 (0.050) +33 bp |
3/132 | 13.1 | 4.6% | noncoding (599/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences |
| ? | NC_000913 | = 2305065 | NA (NA) | noncoding (649/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | |||||
| * | ? | NC_000913 | = 2041150 | NA (NA) | 8 (0.080) | 7/182 | 13.2 | NA | intergenic (+32/‑225) | yedZ/zinT | inner membrane heme subunit for periplasmic YedYZ reductase/zinc and cadmium binding protein, periplasmic |
| ? | NC_000913 | = 2041182 | NA (NA) | noncoding (31/34 nt) | REP142 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP142 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 3548549 | 102 (0.900) | 5 (0.060) +24 bp |
4/150 | 13.5 | 6.1% | coding (1522/2085 nt) | malQ | 4‑alpha‑glucanotransferase (amylomaltase) |
| ? | NC_000913 | 3548574 = | 103 (0.910) | coding (1497/2085 nt) | malQ | 4‑alpha‑glucanotransferase (amylomaltase) | |||||
| * | ? | NC_000913 | = 1987856 | 108 (0.950) | 6 (0.060) | 6/176 | 13.6 | 5.9% | intergenic (‑98/+17) | yecJ/azuC | DUF2766 family protein/acid‑inducible small membrane‑associated protein |
| ? | NC_000913 | = 1987860 | 96 (0.950) | intergenic (‑102/+13) | yecJ/azuC | DUF2766 family protein/acid‑inducible small membrane‑associated protein | |||||
| * | ? | NC_000913 | = 3587439 | 110 (0.970) | 7 (0.070) | 6/178 | 13.7 | 6.5% | coding (675/744 nt) | ugpQ | glycerophosphodiester phosphodiesterase, cytosolic |
| ? | NC_000913 | = 3587453 | 103 (1.010) | coding (661/744 nt) | ugpQ | glycerophosphodiester phosphodiesterase, cytosolic | |||||
| * | ? | NC_000913 | 1198454 = | 152 (1.340) | 6 (0.070) +28 bp |
3/142 | 13.8 | 5.1% | intergenic (‑217/‑241) | ymfE/lit | e14 prophage; putative inner membrane protein/T4 phage exclusion protein; cell death peptidase, e14 prophage |
| ? | NC_000913 | = 1198505 | 158 (1.390) | intergenic (‑268/‑190) | ymfE/lit | e14 prophage; putative inner membrane protein/T4 phage exclusion protein; cell death peptidase, e14 prophage | |||||
| * | ? | NC_000913 | 164547 = | 97 (0.850) | 6 (0.060) | 6/180 | 13.8 | 6.9% | intergenic (+13/‑183) | hrpB/mrcB | putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase |
| ? | NC_000913 | 289267 = | 75 (0.730) | intergenic (‑105/+34) | yagI/argF | CP4‑6 prophage; putative DNA‑binding transcriptional regulator/ornithine carbamoyltransferase 2, chain F; CP4‑6 prophage | |||||
| * | ? | NC_000913 | 1198454 = | 152 (1.340) | 6 (0.070) +CATTTCATCATTTCATCATT |
4/158 | 14.0 | 4.6% | intergenic (‑217/‑241) | ymfE/lit | e14 prophage; putative inner membrane protein/T4 phage exclusion protein; cell death peptidase, e14 prophage |
| ? | NC_000913 | = 1198505 | 158 (1.390) | intergenic (‑268/‑190) | ymfE/lit | e14 prophage; putative inner membrane protein/T4 phage exclusion protein; cell death peptidase, e14 prophage | |||||