Sample Resequencing Stats

Note: The mutation counts shown below represent unfiltered mutation sets.
ALE, Flask, Isolate Predicted Mutations Mean Coverage Total Reads Percent Mapped Mapped Reads Average Read Length
A2 F8 I0 R1 82 77.9 2158605 86.8% 1873669 62.5

Breseq alignment

BRESEQ :: Evidence
Predicted mutation
evidence seq id position mutation freq annotation gene description
RA minE 1,027,446 A→G 100% N134S (AAC→AGC)  malX → fused maltose and glucose‑specific PTS enzyme IIBC components

Read alignment evidence...
  seq id position ref new freq score (cons/poly) reads annotation genes product
*minE1,027,4460AG91.7% 32.8 / ‑3.1 12N134S (AAC→AGC) malXfused maltose and glucose‑specific PTS enzyme IIBC components
Reads supporting (aligned to +/- strand):  ref base A (1/0);  new base G (0/11);  total (1/11)
Fisher's exact test for biased strand distribution p-value = 8.33e-02
Kolmogorov-Smirnov test that lower quality scores support variant p-value = 9.85e-01
Rejected as polymorphism: E-value score below prediction cutoff.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.

CTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAACATCCAGAGCATTCTTGGGATCCAGTCGATCGATA  >  minE/1027409‑1027481
                                     |                                   
cTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAGCATCCag                              <  1:11187/45‑1 (MQ=255)
cTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAGCATCCag                              <  1:1244855/45‑1 (MQ=255)
cTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAGCATCCag                              <  1:1410990/45‑1 (MQ=255)
cTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAGCATCCag                              <  1:1804252/45‑1 (MQ=255)
cTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAGCATCCag                              <  1:1894014/45‑1 (MQ=255)
cTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAGCATCCag                              <  1:2074351/45‑1 (MQ=255)
cTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAGCATCCag                              <  1:268057/45‑1 (MQ=255)
cTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAGCATCCag                              <  1:357258/45‑1 (MQ=255)
cTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAGCATCCag                              <  1:428581/45‑1 (MQ=255)
cTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAGCATCCag                              <  1:675019/45‑1 (MQ=255)
 tGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAGCATCCag                              <  1:538006/44‑1 (MQ=255)
        cACGGATGCCGCGGTTCTGAAAGCCAATAACATCCAGAGCATTCTTGGGATCCAGTCGATCGATa  >  1:1842400/1‑65 (MQ=255)
                                     |                                   
CTGCCAACCACGGATGCCGCGGTTCTGAAAGCCAATAACATCCAGAGCATTCTTGGGATCCAGTCGATCGATA  >  minE/1027409‑1027481

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 

GATK/CNVnator alignment

N/A