![]() |
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence (highest frequency 20 of 25 shown, sorted by frequency from high to low) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | AP012306 | 1,091,992 | 0 | T | G | 36.4% | 475.6 / 54.2 | 243 | intergenic (+38/‑145) | narI/ychS | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/predicted protein |
| * | AP012306 | 1,944,288 | 0 | A | C | 35.6% | 395.0 / 63.3 | 219 | G361G (GGT→GGG) | menE | o‑succinylbenzoate‑CoA ligase |
| * | AP012306 | 3,020,670 | 0 | T | G | 33.3% | 383.0 / 11.5 | 219 | K195N (AAA→AAC) | glgC | glucose‑1‑phosphate adenylyltransferase |
| * | AP012306 | 644,417 | 0 | G | A | 31.9% | 809.1 / inf | 561 | intergenic (+32/‑401) | lysQ/nadA | tRNA‑Lys/quinolinate synthase, subunit A |
| * | AP012306 | 1,226,557 | 0 | A | G | 28.0% | 366.1 / 82.6 | 175 | G55G (GGA→GGG) | ydcU | predicted spermidine/putrescine transporter subunit |
| * | AP012306 | 2,212,753 | 0 | A | C | 27.7% | 374.5 / 53.8 | 159 | Y241D (TAT→GAT) | hcaT | predicted 3‑phenylpropionic transporter |
| * | AP012306 | 800,675 | 0 | A | C | 27.5% | 542.7 / 45.4 | 241 | T192P (ACC→CCC) | lolA | chaperone for lipoproteins |
| * | AP012306 | 341,377 | 0 | T | G | 27.4% | 256.2 / 19.8 | 146 | G60G (GGT→GGG) | ribD | fused diaminohydroxyphosphoribosylaminopyrimidin e deaminase and 5‑amino‑6‑(5‑phosphoribosylamino) uracil reductase |
| * | AP012306 | 3,938,887 | 0 | C | T | 27.3% | 516.5 / 145.1 | 249 | S44F (TCT→TTT) | bglJ | DNA‑binding transcriptional regulator |
| * | AP012306 | 3,527,368 | 0 | A | C | 27.0% | 689.0 / 43.6 | 272 | L140F (TTA→TTC) | rhaS | DNA‑binding transcriptional activator, L‑rhamnose‑binding |
| * | AP012306 | 2,758,909 | 0 | T | G | 26.7% | 515.7 / 13.3 | 206 | G33G (GGT→GGG) | agaD | N‑acetylgalactosamine‑specific enzyme IID component of PTS |
| * | AP012306 | 1,854,851 | 0 | A | C | 26.0% | 735.0 / 72.5 | 296 | T25P (ACC→CCC) | yejH | predicted ATP‑dependet helicase |
| * | AP012306 | 935,054 | 0 | G | T | 25.3% | 260.1 / 39.0 | 95 | intergenic (+24/‑1406) | putP/ycdO | proline:sodium symporter/conserved protein |
| * | AP012306 | 1,128,412 | 0 | T | G | 24.4% | 822.9 / 48.8 | 320 | V29G (GTG→GGG) | yciO | conserved protein |
| * | AP012306 | 2,714,555 | 0 | T | G | 23.7% | 709.7 / 17.3 | 291 | T175P (ACC→CCC) | ygjV | conserved inner membrane protein |
| * | AP012306 | 202,417 | 0 | T | G | 23.3% | 657.4 / 38.6 | 270 | V409G (GTA→GGA) | tilS | tRNA(Ile)‑lysidine synthetase |
| * | AP012306 | 3,094,184 | 0 | A | C | 23.2% | 1118.1 / 47.7 | 452 | V209G (GTG→GGG) | yhiD | predicted Mg(2+) transport ATPase inner membrane protein |
| * | AP012306 | 3,590,367 | 0 | A | C | 22.2% | 834.1 / 31.9 | 293 | T30P (ACC→CCC) | fabR | DNA‑binding transcriptional repressor |
| * | AP012306 | 2,499,414 | 0 | A | C | 21.9% | 972.1 / 74.7 | 369 | P126P (CCA→CCC) | yqeI | predicted transcriptional regulator |
| * | AP012306 | 2,560,243 | 0 | T | G | 21.4% | 526.7 / 19.0 | 206 | N419T (AAC→ACC) | pepP | proline aminopeptidase P II |
| Marginal new junction evidence (lowest skew 10 of 38 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | AP012306 | = 997497 | 346 (1.060) | 15 (0.050) | 15/268 | 12.0 | 4.7% | coding (41/1305 nt) | ndh | respiratory NADH dehydrogenase 2/cupric reductase |
| ? | AP012306 | 997993 = | 299 (1.020) | coding (537/1305 nt) | ndh | respiratory NADH dehydrogenase 2/cupric reductase | |||||
| * | ? | AP012306 | = 1092512 | 389 (1.200) | 14 (0.050) | 11/258 | 13.0 | 4.3% | intergenic (+100/+3) | ychS/tpr | predicted protein/predicted protamine‑like protein |
| ? | AP012306 | 1092985 = | 280 (1.000) | noncoding (66/85 nt) | tyrT | tRNA‑Tyr | |||||
| * | ? | AP012306 | = 1092334 | 285 (0.880) | 9 (0.030) | 8/258 | 14.1 | 3.3% | coding (198/276 nt) | ychS | predicted protein |
| ? | AP012306 | 1092985 = | 280 (1.000) | noncoding (66/85 nt) | tyrT | tRNA‑Tyr | |||||
| * | ? | AP012306 | 644310 = | 351 (1.080) | 29 (0.090) +GAG |
8/292 | 14.8 | 7.8% | noncoding (1/76 nt) | lysQ | tRNA‑Lys |
| ? | AP012306 | = 2073420 | 351 (1.080) | noncoding (76/76 nt) | valU | tRNA‑Val | |||||
| * | ? | AP012306 | = 2275071 | 215 (0.660) | 45 (0.160) +GTATCAGTCTGCTTCGCAAG |
6/258 | 15.0 | 15.5% | noncoding (1/76 nt) | gltW | tRNA‑Glu |
| ? | AP012306 | = 3597478 | 354 (1.090) | intergenic (+65/‑107) | rrsB/gltT | 16S ribosomal RNA (rrnB)/tRNA‑Glu | |||||
| * | ? | AP012306 | 644310 = | 351 (1.080) | 26 (0.080) +G |
6/296 | 15.8 | 7.2% | noncoding (1/76 nt) | lysQ | tRNA‑Lys |
| ? | AP012306 | = 2073542 | 323 (0.990) | intergenic (+2/‑45) | valX/valY | tRNA‑Val/tRNA‑Val | |||||
| * | ? | AP012306 | 3165385 = | 423 (1.300) | 5 (0.020) | 5/274 | 15.9 | 1.3% | coding (1451/1455 nt) | xylB | xylulokinase |
| ? | AP012306 | 3165397 = | 396 (1.320) | coding (1439/1455 nt) | xylB | xylulokinase | |||||
| * | ? | AP012306 | = 1810933 | 239 (0.730) | 5 (0.020) | 5/288 | 16.1 | 2.2% | coding (968/1011 nt) | mglC | methyl‑galactoside transporter subunit |
| ? | AP012306 | = 1810942 | 222 (0.710) | coding (959/1011 nt) | mglC | methyl‑galactoside transporter subunit | |||||
| * | ? | AP012306 | 805307 = | 309 (0.950) | 5 (0.020) | 5/292 | 16.2 | 1.6% | coding (1616/2445 nt) | dmsA | dimethyl sulfoxide reductase, anaerobic, subunit A |
| ? | AP012306 | 805325 = | 297 (0.930) | coding (1634/2445 nt) | dmsA | dimethyl sulfoxide reductase, anaerobic, subunit A | |||||
| * | ? | AP012306 | = 795718 | 396 (1.220) | 5 (0.020) | 5/294 | 16.3 | 1.3% | coding (391/495 nt) | lrp | DNA‑binding transcriptional dual regulator, leucine‑binding |
| ? | AP012306 | = 795731 | 390 (1.220) | coding (404/495 nt) | lrp | DNA‑binding transcriptional dual regulator, leucine‑binding | |||||