![]() |
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| RA | 5,344 | C→A | G37G (GGC→GGA) | yaaX → | DUF2502 domain‑containing protein YaaX |
| MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
| RA | 508,538 | G→T | E107D (GAG→GAT) | ybaQ → | putative DNA‑binding transcriptional regulator YbaQ |
| RA | 747,906 | G→T | intergenic (‑137/+15) | abrB ← / ← ybgO | putative regulator/putative fimbrial protein YbgO |
| RA | 889,923 | A→G | intergenic (‑104/‑166) | ybjL ← / → ybjM | putative transport protein YbjL/putative inner membrane protein |
| RA | 1,678,604 | G→T | A60S (GCA→TCA) | ydgH → | DUF1471 domain‑containing protein YdgH |
| JC JC | 1,879,829 | Δ1 bp :: IS186 (–) +6 bp :: Δ1 bp | coding (115‑120/360 nt) | yeaR ← | DUF1971 domain‑containing protein YeaR |
| MC JC | 1,978,503 | Δ776 bp | insB‑5–insA‑5 | insB‑5, insA‑5 | |
| RA | 2,173,363 | Δ2 bp | pseudogene (915‑916/1358 nt) | gatC ← | galactitol‑specific PTS enzyme IIC component |
| RA | 2,174,403 | C→A | C55F (TGC→TTC) | gatB ← | galactitol‑specific PTS enzyme IIB component |
| RA | 2,461,832 | C→A | A176D (GCT→GAT) | fadL → | long‑chain fatty acid outer membrane channel/bacteriophage T2 receptor |
| RA | 2,655,446 | G→T | L305I (CTC→ATC) | pepB ← | aminopeptidase B |
| RA | 2,710,092 | G→T | L25I (CTT→ATT) | rseD ← | rpoE leader peptide |
| JC | 3,307,452 | (AGTGCCACGTTTCAGGTGGTCCAG)1→2 | coding (409/1890 nt) | deaD ← | ATP‑dependent RNA helicase DeaD |
| RA | 3,354,487 | C→T | intergenic (‑437/‑238) | yhcC ← / → gltB | radical SAM family oxidoreductase YhcC/glutamate synthase subunit GltB |
| RA | 3,560,455 | +G | pseudogene (151/758 nt) | glpR ← | DNA‑binding transcriptional repressor GlpR |
| RA | 3,794,465 | C→A | S160* (TCG→TAG) | rfaD → | ADP‑L‑glycero‑D‑mannoheptose 6‑epimerase |
| RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
| RA | 3,942,092 | C→A | noncoding (285/1542 nt) | rrsC → | 16S ribosomal RNA |
| RA | 4,058,801 | G→T | R132L (CGC→CTC) | bipA → | ribosome‑dependent GTPase, ribosome assembly factor |
| RA | 4,164,458 | C→A | L274M (CTG→ATG) | btuB → | cobalamin/cobinamide outer membrane transporter |
| RA | 4,261,710 | C→A | S14R (AGC→AGA) | dusA → | tRNA‑dihydrouridine synthase A |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,475,819 | C→T | T128I (ACT→ATT) | yjgL → | protein YjgL |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 3102949 | 3104078 | 1130 | 27 [25] | [25] 27 | mutY | mutY |
| * | * | ÷ | NC_000913 | 3423740–3424234 | 3424535–3424238 | 5–796 | 26 [25] | [24] 27 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 1207790 = | 95 (1.180) | 34 (0.480) | 25/244 | 1.7 | 32.9% | coding (290/630 nt) | ycfK | e14 prophage; protein StfP |
| ? | NC_000913 | 1209619 = | 55 (0.770) | pseudogene (37/537 nt) | stfE | e14 prophage; putative side tail fiber protein fragment | |||||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 86 (1.100) | 56/268 | 0.2 | 100% | intergenic (+253/‑33) | ychE/insH21 | putative inner membrane protein/IS5 transposase and trans‑activator |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+151/‑484) | insH21/oppA | IS5 transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | 3363001 = | 137 (1.700) | 96 (1.200) | 52/274 | 0.3 | 58.2% | coding (195/2382 nt) | yhcD | putative fimbrial usher protein YhcD |
| ? | NC_000913 | 3766087 = | 2 (0.020) | coding (3905/4134 nt) | rhsA | rhs element protein RhsA | |||||
| * | ? | NC_000913 | = 3653230 | NA (NA) | 94 (1.160) | 57/276 | 0.2 | 96.9% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 3766089 | 3 (0.040) | coding (3907/4134 nt) | rhsA | rhs element protein RhsA | |||||