![]() |
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| RA | 231,207 | G→C | G29A (GGC→GCC) | yafD → | endonuclease/exonuclease/phosphatase domain‑containing protein YafD |
| MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
| MC JC | 680,678 | Δ7 bp | coding (467‑473/1452 nt) | djlC → | co‑chaperone DjlC |
| RA | 847,968 | T→G | T13P (ACC→CCC) | glnH ← | L‑glutamine ABC transporter periplasmic binding protein |
| RA | 889,923 | A→G | intergenic (‑104/‑166) | ybjL ← / → ybjM | putative transport protein YbjL/putative inner membrane protein |
| RA | 1,196,220 | C→T | H366H (CAC→CAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,232 | C→T | T370T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,245 | T→C | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,247 | A→G | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,395,845 | C→G | M26I (ATG→ATC) | ynaI ← | small conductance mechanosensitive channel YnaI |
| JC | 1,658,941 | (CGGGCACCGATGCCGCGCTGGTTGCGGGTATTGCC)1→2 | coding (873/2427 nt) | ynfE → | putative selenate reductase YnfE |
| JC JC | 1,879,829 | Δ1 bp :: IS186 (–) +6 bp :: Δ1 bp | coding (115‑120/360 nt) | yeaR ← | DUF1971 domain‑containing protein YeaR |
| MC JC | 1,978,503 | Δ776 bp | insB‑5–insA‑5 | insB‑5, insA‑5 | |
| RA | 2,033,505 | C→A | intergenic (‑21/‑144) | yedR ← / → rseX | putative inner membrane protein/small regulatory RNA RseX |
| RA | 2,059,907 | G→A | noncoding (57/76 nt) | asnU → | tRNA‑Asn |
| RA | 2,101,503 | A→G | pseudogene (242/349 nt) | wbbL ← | interrupted rhamnosyltransferase WbbL |
| RA | 2,173,363 | Δ2 bp | pseudogene (915‑916/1358 nt) | gatC ← | galactitol‑specific PTS enzyme IIC component |
| RA | 2,455,442 | T→C | T69A (ACC→GCC) | yfcV ← | putative fimbrial protein YfcV |
| RA | 2,911,377 | T→C | intergenic (‑38/+40) | mazE ← / ← relA | antitoxin of the MazF‑MazE toxin‑antitoxin system MazE/GDP/GTP pyrophosphokinase |
| RA | 3,354,487 | C→T | intergenic (‑437/‑238) | yhcC ← / → gltB | radical SAM family oxidoreductase YhcC/glutamate synthase subunit GltB |
| RA | 3,380,896 | G→C | A52P (GCA→CCA) | degQ → | periplasmic serine endoprotease |
| RA | 3,560,455 | +G | pseudogene (151/758 nt) | glpR ← | DNA‑binding transcriptional repressor GlpR |
| RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 1196256 | 1211438 | 15183 | 36 [35] | [35] 39 | [icd]–[icdC] | [icd],ymfD,ymfE,lit,intE,xisE,ymfH,ymfI,ymfJ,ymfK,ymfT,ymfL,ymfM,oweE,ymfN,aaaE,ymfR,beeE,jayE,ymfQ,ycfK,tfaP,tfaE,stfE,pinE,mcrA,[icdC] |
| * | * | ÷ | NC_000913 | 3423770–3424233 | 3424533–3424238 | 6–764 | 38 [30] | [33] 36 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 106 (0.950) | 66/268 | 0.3 | 100% | intergenic (+253/‑33) | ychE/insH21 | putative inner membrane protein/IS5 transposase and trans‑activator |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+151/‑484) | insH21/oppA | IS5 transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | 3363001 = | 139 (1.210) | 170 (1.490) | 74/274 | 0.2 | 70.5% | coding (195/2382 nt) | yhcD | putative fimbrial usher protein YhcD |
| ? | NC_000913 | 3766087 = | 4 (0.030) | coding (3905/4134 nt) | rhsA | rhs element protein RhsA | |||||
| * | ? | NC_000913 | = 3653230 | NA (NA) | 88 (0.760) | 60/276 | 0.5 | 94.6% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 3766089 | 5 (0.040) | coding (3907/4134 nt) | rhsA | rhs element protein RhsA | |||||