mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence (highest frequency 20 of 33 shown, sorted by frequency from high to low) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | AP012306 | 1,091,992 | 0 | T | G | 46.9% | 283.2 / 90.0 | 228 | intergenic (+38/‑145) | narI/ychS | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/predicted protein |
| * | AP012306 | 1,944,288 | 0 | A | C | 39.8% | 306.3 / 79.2 | 207 | G361G (GGT→GGG) | menE | o‑succinylbenzoate‑CoA ligase |
| * | AP012306 | 341,377 | 0 | T | G | 32.6% | 173.6 / 23.4 | 99 | G60G (GGT→GGG) | ribD | fused diaminohydroxyphosphoribosylaminopyrimidin e deaminase and 5‑amino‑6‑(5‑phosphoribosylamino) uracil reductase |
| * | AP012306 | 3,527,368 | 0 | A | C | 32.6% | 511.2 / 63.6 | 242 | L140F (TTA→TTC) | rhaS | DNA‑binding transcriptional activator, L‑rhamnose‑binding |
| * | AP012306 | 935,054 | 0 | G | T | 32.1% | 165.9 / 45.8 | 84 | intergenic (+24/‑1406) | putP/ycdO | proline:sodium symporter/conserved protein |
| * | AP012306 | 2,680,345 | 0 | A | C | 30.5% | 316.8 / 46.3 | 179 | T184P (ACC→CCC) | ttdA | L‑tartrate dehydratase, alpha subunit |
| * | AP012306 | 800,675 | 0 | A | C | 29.3% | 533.9 / 40.3 | 240 | T192P (ACC→CCC) | lolA | chaperone for lipoproteins |
| * | AP012306 | 3,639,040 | 0 | T | G | 28.9% | 147.4 / 12.6 | 76 | noncoding (54/76 nt) | gltV | tRNA‑Glu |
| * | AP012306 | 644,417 | 0 | G | A | 27.4% | 1011.3 / inf | 569 | intergenic (+32/‑401) | lysQ/nadA | tRNA‑Lys/quinolinate synthase, subunit A |
| * | AP012306 | 3,938,887 | 0 | C | T | 27.1% | 504.7 / 142.3 | 247 | S44F (TCT→TTT) | bglJ | DNA‑binding transcriptional regulator |
| * | AP012306 | 1,128,412 | 0 | T | G | 26.9% | 612.8 / 56.9 | 258 | V29G (GTG→GGG) | yciO | conserved protein |
| * | AP012306 | 202,417 | 0 | T | G | 26.6% | 528.1 / 24.2 | 232 | V409G (GTA→GGA) | tilS | tRNA(Ile)‑lysidine synthetase |
| * | AP012306 | 257,137 | 0 | T | G | 26.4% | 368.0 / 20.1 | 178 | L496V (TTG→GTG) | betT | choline transporter of high affinity |
| * | AP012306 | 2,212,753 | 0 | A | C | 25.2% | 286.8 / 33.6 | 119 | Y241D (TAT→GAT) | hcaT | predicted 3‑phenylpropionic transporter |
| * | AP012306 | 1,226,557 | 0 | A | G | 24.8% | 341.8 / 55.5 | 150 | G55G (GGA→GGG) | ydcU | predicted spermidine/putrescine transporter subunit |
| * | AP012306 | 2,560,243 | 0 | T | G | 24.6% | 421.2 / 22.3 | 171 | N419T (AAC→ACC) | pepP | proline aminopeptidase P II |
| * | AP012306 | 1,421,147 | 0 | T | G | 24.5% | 420.7 / 10.2 | 207 | T79P (ACC→CCC) | ydhB | predicted DNA‑binding transcriptional regulator |
| * | AP012306 | 2,558,071 | 0 | A | C | 24.1% | 517.7 / 27.8 | 212 | V302G (GTA→GGA) | visC | predicted oxidoreductase, FAD/NAD(P)‑binding domain |
| * | AP012306 | 1,066,323 | 0 | A | C | 23.3% | 594.0 / 13.2 | 215 | intergenic (‑92/+33) | ychM/prsA | predicted transporter/phosphoribosylpyrophosphate synthase |
| * | AP012306 | 3,282,076 | 0 | T | G | 23.1% | 534.7 / 18.7 | 238 | intergenic (‑79/+27) | ilvB/ivbL | acetolactate synthase I, large subunit/ilvB operon leader peptide |
| Marginal new junction evidence (lowest skew 10 of 104 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | AP012306 | = 215364 | NA (NA) | 14 (0.050) | 12/288 | 8.1 | NA | noncoding (745/2905 nt) | rrlH | 23S ribosomal RNA (rrlH) |
| ? | AP012306 | = 215372 | NA (NA) | noncoding (753/2905 nt) | rrlH | 23S ribosomal RNA (rrlH) | |||||
| * | ? | AP012306 | = 1092334 | 293 (0.980) | 10 (0.040) | 9/258 | 8.5 | 3.5% | coding (198/276 nt) | ychS | predicted protein |
| ? | AP012306 | 1092985 = | 297 (1.150) | noncoding (66/85 nt) | tyrT | tRNA‑Tyr | |||||
| * | ? | AP012306 | = 42209 | 248 (0.830) | 7 (0.030) | 7/270 | 9.2 | 3.0% | coding (139/531 nt) | kefF | flavoprotein subunit for the KefC potassium efflux system |
| ? | AP012306 | = 42195 | 231 (0.860) | coding (125/531 nt) | kefF | flavoprotein subunit for the KefC potassium efflux system | |||||
| * | ? | AP012306 | = 2490688 | 287 (0.960) | 7 (0.020) | 7/290 | 9.4 | 2.4% | coding (483/693 nt) | ygeA | predicted racemase |
| ? | AP012306 | = 2490701 | 287 (0.990) | coding (470/693 nt) | ygeA | predicted racemase | |||||
| * | ? | AP012306 | = 1092512 | 356 (1.200) | 14 (0.050) | 6/258 | 9.4 | 4.4% | intergenic (+100/+3) | ychS/tpr | predicted protein/predicted protamine‑like protein |
| ? | AP012306 | 1092985 = | 298 (1.160) | noncoding (66/85 nt) | tyrT | tRNA‑Tyr | |||||
| * | ? | AP012306 | 3597644 = | 246 (0.830) | 7 (0.030) | 6/274 | 9.6 | 3.0% | noncoding (60/76 nt) | gltT | tRNA‑Glu |
| ? | AP012306 | 3639058 = | NA (NA) | noncoding (72/76 nt) | gltV | tRNA‑Glu | |||||
| * | ? | AP012306 | = 3240654 | 429 (1.440) | 6 (0.020) | 6/274 | 9.6 | 1.5% | coding (234/237 nt) | rpmB | 50S ribosomal subunit protein L28 |
| ? | AP012306 | = 3240642 | 388 (1.420) | intergenic (‑12/+9) | rpmG/rpmB | 50S ribosomal subunit protein L33/50S ribosomal subunit protein L28 | |||||
| * | ? | AP012306 | = 2275071 | 224 (0.750) | 45 (0.170) +GTATCAGTCTGCTTCGCAAG |
5/258 | 9.7 | 15.9% | noncoding (1/76 nt) | gltW | tRNA‑Glu |
| ? | AP012306 | = 3597478 | 326 (1.100) | intergenic (+65/‑107) | rrsB/gltT | 16S ribosomal RNA (rrnB)/tRNA‑Glu | |||||
| * | ? | AP012306 | = 3805843 | 360 (1.210) | 6 (0.020) | 6/290 | 9.8 | 1.7% | intergenic (+42/‑134) | ecnB/sugE | entericidin B membrane lipoprotein/multidrug efflux system protein |
| ? | AP012306 | = 3805868 | 338 (1.170) | intergenic (+67/‑109) | ecnB/sugE | entericidin B membrane lipoprotein/multidrug efflux system protein | |||||
| * | ? | AP012306 | = 3017771 | 281 (0.940) | 6 (0.020) | 6/290 | 9.8 | 2.2% | coding (737/2448 nt) | glgP | glycogen phosphorylase |
| ? | AP012306 | = 3017781 | 265 (0.920) | coding (727/2448 nt) | glgP | glycogen phosphorylase | |||||