mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.33.1 revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | NC_000913 | 3,107,154 | 0 | C | G | 55.6% | ‑2.1 / 10.8 | 9 | A668P (GCG→CCG) | speC | ornithine decarboxylase, constitutive |
| * | NC_000913 | 1,984,188 | 0 | C | G | 54.2% | ‑2.0 / 40.6 | 25 | G294G (GGG→GGC) | araG | L‑arabinose ABC transporter ATPase |
| * | NC_000913 | 1,667,883 | 0 | C | G | 50.0% | 6.0 / 12.5 | 17 | V228L (GTC→CTC) | mlc | glucosamine anaerobic growth regulon transcriptional repressor; autorepressor |
| * | NC_000913 | 2,879,536 | 0 | C | G | 50.0% | 6.0 / 12.8 | 18 | G79G (GGG→GGC) | ygbT | multifunctional endonuclease Cas1, CRISPR adaptation protein; DNA repair enzyme |
| * | NC_000913 | 1,527,602 | 0 | G | C | 47.8% | 17.9 / 19.6 | 26 | intergenic (+450/‑300) | yncH/rhsE | IPR020099 family protein/pseudogene, Rhs family |
| * | NC_000913 | 2,367,979 | 0 | C | G | 42.1% | 8.5 / 12.3 | 19 | R303R (CGC→CGG) | arnC | undecaprenyl phosphate‑L‑Ara4FN transferase |
| * | NC_000913 | 4,296,060 | 0 | C | T | 37.1% | 29.4 / 37.9 | 36 | intergenic (+266/+376) | gltP/yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
| * | NC_000913 | 3,046,078 | 0 | G | A | 35.3% | 11.7 / 13.3 | 17 | intergenic (‑177/+90) | ygfF/gcvP | putative NAD(P)‑dependent oxidoreductase/glycine decarboxylase, PLP‑dependent, subunit P of glycine cleavage complex |
| * | NC_000913 | 3,046,074 | 0 | C | T | 33.3% | 8.6 / 11.2 | 15 | intergenic (‑173/+94) | ygfF/gcvP | putative NAD(P)‑dependent oxidoreductase/glycine decarboxylase, PLP‑dependent, subunit P of glycine cleavage complex |
| * | NC_000913 | 1,810,533 | 1 | . | G | 30.8% | 12.0 / 16.6 | 13 | coding (323/591 nt) | ydjM | inner membrane protein regulated by LexA |
| Marginal new junction evidence (sorted from low to high skew) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 805949 = | 40 (2.150) | 3 (0.230) +AAAACAACTAAAATTCAATA |
3/92 | 1.2 | 9.8% | noncoding (146/178 nt) | REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences |
| ? | NC_000913 | = 3625674 | NA (NA) | intergenic (+160/+5) | yhhI/yhhJ | putative transposase/putative ABC transporter permease | |||||
| * | ? | NC_000913 | 3037860 = | 17 (0.920) | 3 (0.190) | 3/110 | 1.5 | 17.1% | coding (247/1734 nt) | recJ | ssDNA exonuclease, 5' ‑‑> 3'‑specific |
| ? | NC_000913 | 3037943 = | 15 (0.970) | coding (164/1734 nt) | recJ | ssDNA exonuclease, 5' ‑‑> 3'‑specific | |||||
| * | ? | NC_000913 | = 3330463 | 20 (1.190) | 3 (0.180) | 3/120 | 1.6 | 13.0% | noncoding (4/98 nt) | RIP243 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP243 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site |
| ? | NC_000913 | 3740968 = | NA (NA) | noncoding (5/98 nt) | RIP269 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP269 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||
| * | ? | NC_000913 | = 3071424 | 18 (0.970) | 4 (0.250) | 3/116 | 1.6 | 19.6% | intergenic (‑180/+35) | fbaA/pgk | fructose‑bisphosphate aldolase, class II/phosphoglycerate kinase |
| ? | NC_000913 | = 3071467 | 17 (1.040) | coding (1156/1164 nt) | pgk | phosphoglycerate kinase | |||||
| * | ? | NC_000913 | = 1826656 | 13 (0.700) | 3 (0.180) | 3/120 | 1.6 | 13.1% | coding (268/969 nt) | astE | succinylglutamate desuccinylase |
| ? | NC_000913 | = 1826936 | 28 (1.660) | coding (1324/1344 nt) | astB | succinylarginine dihydrolase | |||||
| * | ? | NC_000913 | = 857644 | 20 (1.080) | 5 (0.300) | 3/118 | 1.6 | 21.9% | noncoding (29/98 nt) | RIP79 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP79 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site |
| ? | NC_000913 | = 857679 | NA (NA) | noncoding (64/98 nt) | RIP79 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP79 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||